manea

Ensembl ID:
ENSDARG00000001898
ZFIN ID:
ZDB-GENE-040912-87
Description:
mannosidase, endo-alpha [Source:RefSeq peptide;Acc:NP_001004566]
Human Orthologue:
MANEA
Human Description:
mannosidase, endo-alpha [Source:HGNC Symbol;Acc:21072]
Mouse Orthologue:
Manea
Mouse Description:
mannosidase, endo-alpha Gene [Source:MGI Symbol;Acc:MGI:2444484]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa42897 Nonsense Mutation detected in F1 DNA During 2016
sa23028 Nonsense Mutation detected in F1 DNA During 2016
sa28827 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa42897
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000040605   None 148 2 3
ENSDART00000124672 Nonsense 27 438 1 4
ENSDART00000132571 Nonsense 27 219 2 3
ENSDART00000142972 Nonsense 27 438 3 6
Genomic Location:
Chromosome 17 (position 15504876)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTGCAGTCATCGTTTTAGCCTTAGCTGTGTTCATTATAACAGTCATCCTT[A/T]AGTCTCTAAGCCCTGAAGATAACATTTCCGGCAGCCATTTTGCAGTAAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23028
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000040605   None 148 3 3
ENSDART00000124672 Nonsense 212 438 3 4
ENSDART00000132571   None 219 3 3
ENSDART00000142972 Nonsense 212 438 5 6
Genomic Location:
Chromosome 17 (position 15501406)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TATTTGTTCCTCCATGACAGGTTGTGTTTCATATTGAACCATACAAAGGA[C/T]GAGACGATGCAAATATGCGTGAAAATATTCAGTATATTGTGGATCGGTAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa28827
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000040605   None 148 3 3
ENSDART00000124672 Nonsense 436 438 4 4
ENSDART00000132571   None 219 3 3
ENSDART00000142972 Nonsense 436 438 6 6
Genomic Location:
Chromosome 17 (position 15500429)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGAGATAACGCAAAGGTGGGCTAGAAAGTTTAGCGACGAGCAGAAGAAGT[G/A]GCTGGAGTAGTTTTATTGGTCATCCTGGAAAAACAACTGTTGGGGCTTGT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link