ppm1ba

Ensembl ID:
ENSDARG00000001888
ZFIN ID:
ZDB-GENE-991102-16
Description:
protein phosphatase 1B [Source:RefSeq peptide;Acc:NP_571473]
Human Orthologue:
PPM1B
Human Description:
protein phosphatase, Mg2+/Mn2+ dependent, 1B [Source:HGNC Symbol;Acc:9276]
Mouse Orthologue:
Ppm1b
Mouse Description:
protein phosphatase 1B, magnesium dependent, beta isoform Gene [Source:MGI Symbol;Acc:MGI:101841]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa10629 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa10629
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000013103 Nonsense 303 390 3 6
ENSDART00000126725   None 250 None 3
ENSDART00000144755 Nonsense 303 390 4 7
Genomic Location (Zv9):
Chromosome 13 (position 10261339)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 10563668
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAAGTCGAGATAATATGAGTATTGTATTAGTTTGTTTGCCAAATGCACCC[C/T]AGGTGTCAGAGGATGCAGTAAAGAGAGATGCAGAGTTGGACAAGTATCTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link