kbtbd12

Ensembl ID:
ENSDARG00000001882
ZFIN ID:
ZDB-GENE-050904-1
Description:
Kelch repeat and BTB domain-containing protein 12 [Source:UniProtKB/Swiss-Prot;Acc:Q3ZB90]
Human Orthologue:
KBTBD12
Human Description:
kelch repeat and BTB (POZ) domain containing 12 [Source:HGNC Symbol;Acc:25731]
Mouse Orthologue:
Kbtbd12
Mouse Description:
kelch repeat and BTB (POZ) domain containing 12 Gene [Source:MGI Symbol;Acc:MGI:1918481]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa38572 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa38572
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000035101 Nonsense 198 623 2 6
Genomic Location (Zv9):
Chromosome 6 (position 40652036)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 40723636
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTTTCACGAGAAGAGAGCATTTTGGATGTGGTGATGCGCTGGGTGAAGTA[C/A]TGTCCCGGAGATGTTGGGTCAGAGGAAGAGAACCGGGCCAGGCACCTTCC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link