cacnb3a

Ensembl ID:
ENSDARG00000001881
ZFIN ID:
ZDB-GENE-060221-2
Description:
calcium channel, voltage-dependent, beta 3a [Source:RefSeq peptide;Acc:NP_001077024]
Human Orthologue:
CACNB3
Human Description:
calcium channel, voltage-dependent, beta 3 subunit [Source:HGNC Symbol;Acc:1403]
Mouse Orthologue:
Cacnb3
Mouse Description:
calcium channel, voltage-dependent, beta 3 subunit Gene [Source:MGI Symbol;Acc:MGI:103307]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa37643 Essential Splice Site Available for shipment Available now
sa24273 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa37643
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000014825 Essential Splice Site 373 439 12 15
ENSDART00000087280 Essential Splice Site 368 434 12 15

The following transcripts of ENSDARG00000001881 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 23 (position 14271523)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 14403456
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCTCAATGTTCAGATGATGGCAGCAGATAAATTGACTCAGTGTCCCCCTG[T/A]AAGTACTTTAACACTTTTTAGTTATTCAAATCACACTAGATTGAACATTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24273
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000014825 Essential Splice Site None 439 15 15
ENSDART00000087280 Essential Splice Site None 434 15 15

The following transcripts of ENSDARG00000001881 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 23 (position 14291682)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 14423615
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCATGTGACCTCAGTATTGTTTAGAGTGTTCATCTCTCTCTTTCTGTCCC[A/T]GAACCAGCAGCTGTCGCCTGCCGGGGGTGGAGTGGGAGTGGAGGAGGAGG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link