si:ch211-169k21.2

Ensembl ID:
ENSDARG00000001879
ZFIN IDs:
ZDB-GENE-061207-13, ZDB-GENE-080225-19, ZDB-GENE-080225-19
Description:
Novel protein [Source:UniProtKB/TrEMBL;Acc:A2CEB9]
Human Orthologue:
NAV2
Human Description:
neuron navigator 2 [Source:HGNC Symbol;Acc:15997]
Mouse Orthologue:
Nav2
Mouse Description:
neuron navigator 2 Gene [Source:MGI Symbol;Acc:MGI:2183691]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa14333 Nonsense Available for shipment Available now
sa14752 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa14333
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000073629 Nonsense 759 1110 8 12
ENSDART00000131502   None 174 None 3
ENSDART00000143666   None 518 None 6

The following transcripts of ENSDARG00000001879 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 25 (position 14809091)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 14452014
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCTGTCGATGAWGGATACCTTCCCCCAAGTGCTCGGACGACACTTCAGTA[T/A]CGGAGTTTACCAAGACCTAGCCGAACCRGTGCCACTCGCTGTTCAAATCG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14752
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000073629 Nonsense 963 1110 9 12
ENSDART00000131502   None 174 None 3
ENSDART00000143666   None 518 None 6

The following transcripts of ENSDARG00000001879 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 25 (position 14803969)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 14446892
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAAGCTCCAACCACACCAATAGTGACTCCATAGATGTTTGCTTGGGAAAA[G/T]AAGATTTRTGTCTTAATCGTGTCAACAGTGCCCGAACCGGCCTCTCAGAC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link