phgdh

Ensembl ID:
ENSDARG00000001873
ZFIN ID:
ZDB-GENE-030131-647
Description:
D-3-phosphoglycerate dehydrogenase [Source:RefSeq peptide;Acc:NP_955871]
Human Orthologue:
PHGDH
Human Description:
phosphoglycerate dehydrogenase [Source:HGNC Symbol;Acc:8923]
Mouse Orthologues:
Gm6756, Phgdh
Mouse Descriptions:
3-phosphoglycerate dehydrogenase Gene [Source:MGI Symbol;Acc:MGI:1355330]
predicted gene 6756 Pseudogene [Source:MGI Symbol;Acc:MGI:3647509]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa16263 Nonsense Available for shipment Available now
sa1248 Nonsense F2 line generated During 2017

Mutation Details

Allele Name:
sa16263
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000012938 Nonsense 197 528 6 12
Genomic Location (Zv9):
Chromosome 9 (position 49191443)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 48506513
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAGGTGTCTGCSAGCTGGGGTGTGGAGCAGATGACTCTGGATCAGTTGTG[G/A]CCGCAGTGTGAYTATATCACAGTCCACACTCCYCTCATGSCCTCCACCAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1248
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000012938 Nonsense 467 528 11 12
Genomic Location (Zv9):
Chromosome 9 (position 49176773)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 48491843
KASP Assay ID:
554-1163.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CGACAGCCTGTTCCTCTGACTGGACACCTGCTGTTCTTCAGGGCCAATTG[T/A]TCCACGGAGTTCCTGTCCTCCATAACCGGTAAACACTCATTCACATTCTG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link