atp1a1a.4

Ensembl ID:
ENSDARG00000001870
ZFIN ID:
ZDB-GENE-001212-4
Description:
ATPase, Na+/K+ transporting, alpha 1a.4 polypeptide [Source:RefSeq peptide;Acc:NP_571764]
Human Orthologue:
ATP1A1
Human Description:
ATPase, Na+/K+ transporting, alpha 1 polypeptide [Source:HGNC Symbol;Acc:799]
Mouse Orthologue:
Atp1a1
Mouse Description:
ATPase, Na+/K+ transporting, alpha 1 polypeptide Gene [Source:MGI Symbol;Acc:MGI:88105]

Alleles

There are 7 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa19396 Nonsense Mutation detected in F1 DNA During 2014
sa19397 Nonsense Mutation detected in F1 DNA During 2014
sa17542 Nonsense Available for shipment Available now
sa14454 Nonsense Available for shipment Available now
sa14079 Nonsense Available for shipment Available now
sa13870 Nonsense Available for shipment Available now
sa3340 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa19396
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000048828 Nonsense 505 1024 11 22

The following transcripts of ENSDARG00000001870 do not overlap with this mutation:

Genomic Location:
Chromosome 1 (position 1456708)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCTCTAGCTTTCAATCCACAAGAATCCCAATTCCTCAGAGCCAAAACACT[T/A]GCTTGTGATGAAGGGAGCACCTGAGAGGATCTTGGATCGATGCTCCACCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19397
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000048828 Nonsense 543 1024 11 22

The following transcripts of ENSDARG00000001870 do not overlap with this mutation:

Genomic Location:
Chromosome 1 (position 1456823)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAACAGCAGCCCTTAGATGAAGAAATGAAAGATGCTTTTCAGAATGCTTA[T/A]GTTGAACTTGGAGGTCTTGGAGAAAGAGTCCTGGGTAAATTCCCCAAATG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17542
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000048828 Nonsense 672 1024 14 22

The following transcripts of ENSDARG00000001870 do not overlap with this mutation:

Genomic Location:
Chromosome 1 (position 1457650)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGTGTGCCTTTAGAGATGCGAAGGCATGTGTGGTCCATGGAGGAGAACTG[A/T]AAAGTATGAGYGAAGAAGAGCTAGATGATATCCTGAAACACCATACWGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14454
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000048828 Nonsense 822 1024 17 22

The following transcripts of ENSDARG00000001870 do not overlap with this mutation:

Genomic Location:
Chromosome 1 (position 1459898)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GATTGCAAATGTTAAYTATTGTTTAATGTTTCCTCAGGTTCCTGCGATCT[C/A]KTTGGCCTMTGAAAGTGCWGAAAGTRACATCATGAAGWGACAACCCAGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14079
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000048828 Nonsense 835 1024 17 22
ENSDART00000048828 Nonsense 835 1024 17 22

The following transcripts of ENSDARG00000001870 do not overlap with this mutation:

Genomic Location:
Chromosome 1 (position 1459936)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTCCTGCGATCTMKTTGGCCTMTGAAAGTGCWGAAAGTRACATCATGAAG[A/T]GACAACCCAGAAATGCTAAAACAGATAAACTGGTGAACGAGAGGCTGATC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13870
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000048828 Nonsense 835 1024 17 22
ENSDART00000048828 Nonsense 835 1024 17 22

The following transcripts of ENSDARG00000001870 do not overlap with this mutation:

Genomic Location:
Chromosome 1 (position 1459936)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTCCTGCGATCTMKTTGGCCTMTGAAAGTGCWGAAAGTRACATCATGAAG[A/T]GACAACCCAGAAATGCTAAAACAGATAAACTGGTGAACGAGAGGCTGATC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa3340
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000048828 Nonsense 912 1024 19 22

The following transcripts of ENSDARG00000001870 do not overlap with this mutation:

Genomic Location:
Chromosome 1 (position 1460931)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAATCATGTAAACATTGCTCGTCTGTTTATGTTCCTAGACATACGAGCGC[A/T]GAAAGATTGTGGAGTTCACATGCCACACAGCCTTCTTCGCCAGTATTGTG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/c34yurf1