si:ch211-223p8.5

Ensembl ID:
ENSDARG00000001825
ZFIN ID:
ZDB-GENE-080815-3
Description:
Novel protein [Source:UniProtKB/TrEMBL;Acc:B7ZD03]
Human Orthologue:
C10orf79
Human Description:
chromosome 10 open reading frame 79 [Source:HGNC Symbol;Acc:26684]
Mouse Orthologue:
D19Ertd652e
Mouse Description:
DNA segment, Chr 19, ERATO Doi 652, expressed Gene [Source:MGI Symbol;Acc:MGI:1289258]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa22296 Nonsense Available for shipment Available now
sa35482 Essential Splice Site Mutation detected in F1 DNA During 2017
sa22297 Nonsense Available for shipment Available now
sa35483 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa22296
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000002858 Nonsense 48 1642 2 38
ENSDART00000147713 Nonsense 57 1651 2 38
Genomic Location (Zv9):
Chromosome 13 (position 24942209)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 24587869
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAGTTTGCTACACCTGCGGAAACTTCATCGTTTTCCTCAATGTGGAAACT[A/T]AAGAGAGGAAGACGCTGCAGAGTCCCGGCTCTGGTATTGGAGCATTTACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35482
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000002858 Essential Splice Site 362 1642 9 38
ENSDART00000147713 Essential Splice Site 371 1651 9 38
Genomic Location (Zv9):
Chromosome 13 (position 24945358)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 24591018
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAAGAAAGGAAATTCACGAGAATGCTTAAAATCTTTTAGTTTTCTTTCTT[A/C]GGGCTGTGTTTACAGATTCAAACCACTGCTAAAGGATAAAGCTGTCAAAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22297
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000002858 Nonsense 1291 1642 31 38
ENSDART00000147713 Nonsense 1300 1651 31 38
Genomic Location (Zv9):
Chromosome 13 (position 24961211)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 24606871
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAGTTTTATGATGTCCCTGGACACTCAATTGACCAGCTATATAAACTTTA[C/A]AAACGCAGACCAAGGTATTATTTCAGAAGATTTGCAGCTTGTTTGTTCAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35483
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000002858 Essential Splice Site 1360 1642 32 38
ENSDART00000147713 Essential Splice Site 1369 1651 32 38
Genomic Location (Zv9):
Chromosome 13 (position 24961499)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 24607159
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGGAGAGGTTTTGCCTGGCAAGACGGGCCAAAGTGGAAAGTGAACAAAAG[G/A]TAAGAATAGCTAGATAAGCTAAATGTCACCCTAATCAAATTTCTAAAGAG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link