si:ch211-140f21.1

Ensembl ID:
ENSDARG00000001818
ZFIN ID:
ZDB-GENE-030131-3063
Description:
complement component 3-like isoform 2 [Source:RefSeq peptide;Acc:NP_001108152]
Human Orthologue:
C3
Human Description:
complement component 3 [Source:HGNC Symbol;Acc:1318]
Mouse Orthologue:
C3
Mouse Description:
complement component 3 Gene [Source:MGI Symbol;Acc:MGI:88227]

Alleles

There are 6 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa30732 Nonsense Mutation detected in F1 DNA During 2017
sa43860 Nonsense Mutation detected in F1 DNA During 2017
sa31073 Nonsense Mutation detected in F1 DNA During 2017
sa43859 Essential Splice Site Mutation detected in F1 DNA During 2017
sa32403 Essential Splice Site Available for shipment Available now
sa30731 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa30732
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108737   None 1690 None 40
ENSDART00000110577 Nonsense 7 323 1 11
ENSDART00000111875   None 323 None 11

The following genes are also affected by this mutation:

Genomic Location (Zv9):
Chromosome 22 (position 26827416)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 26216272
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CATATTGAGTGGCGGTTACTTCAGCAGGACGATGCTTCTTCAGCTGCTGT[T/A]ATGGGCGACCCTGCTCTGTCAAATCTGCGATGGAAAGGCCTTCCCTCAAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43860
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108737   None 1690 None 40
ENSDART00000110577 Nonsense 24 323 1 11
ENSDART00000111875   None 323 None 11
ENSDART00000108737   None 1690 None 40
ENSDART00000110577 Nonsense 24 323 1 11
ENSDART00000111875   None 323 None 11

The following genes are also affected by this mutation:

Genomic Location (Zv9):
Chromosome 22 (position 26827366)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 26216222
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TATGGGCGACCCTGCTCTGTCAAATCTGCGATGGAAAGGCCTTCCCTCAA[C/T]GACAGTGCGTTTAACTCTGCATTATTAACTTTTAATGTGTAAAAATATAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31073
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108737   None 1690 None 40
ENSDART00000110577 Nonsense 24 323 1 11
ENSDART00000111875   None 323 None 11
ENSDART00000108737   None 1690 None 40
ENSDART00000110577 Nonsense 24 323 1 11
ENSDART00000111875   None 323 None 11

The following genes are also affected by this mutation:

Genomic Location (Zv9):
Chromosome 22 (position 26827366)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 26216222
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TATGGGCGACCCTGCTCTGTCAAATCTGCGATGGAAAGGCCTTCCCTCAA[C/T]GACAGTGCGTTTAACTCTGCATTATTAACTTTTAATGTGTAAAAATATAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43859
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108737 Essential Splice Site 46 1690 3 40
ENSDART00000110577 Essential Splice Site 46 323 3 11
ENSDART00000111875 Essential Splice Site 46 323 3 11
Genomic Location (Zv9):
Chromosome 22 (position 26765346)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 26154202
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAGTGTGTTTTTCTGTTTACAGTGAGCCGGTCAAAGACCCTTCTCCGTCG[T/C]GAGTAATTGTCCTCTGCCCTCAGTAAACACACACACACACACACACACAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32403
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108737 Essential Splice Site 247 1690 8 40
ENSDART00000110577 Essential Splice Site 247 323 8 11
ENSDART00000111875 Essential Splice Site 247 323 8 11
Genomic Location (Zv9):
Chromosome 22 (position 26756774)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 26145630
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAGGGAAAAGAGAATGTTTTCAGCAGAGAGTTTGAAGTGAAGAAATATGG[T/G]AATTATATTACCTTCAGATTTGTTTCTTCTACATATTTTTTTCTCTGTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa30731
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108737 Nonsense 1506 1690 37 40
ENSDART00000110577   None 323 None 11
ENSDART00000111875   None 323 None 11
Genomic Location (Zv9):
Chromosome 22 (position 26723665)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 26112521
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAAGCTGTAGCAGGTTCTACTCTCCTCCTGAAGACAAACAGCAGCTGGAT[C/T]AGATCTGTGAAGGCGACGTGTGCCGCTGCTCGCAGGGTCAGTCTCTTTGT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link