tnfrsf21

Ensembl ID:
ENSDARG00000001807
ZFIN ID:
ZDB-GENE-030131-5971
Description:
tumor necrosis factor receptor superfamily member 21 [Source:RefSeq peptide;Acc:NP_001036153]
Human Orthologue:
TNFRSF21
Human Description:
tumor necrosis factor receptor superfamily, member 21 [Source:HGNC Symbol;Acc:13469]
Mouse Orthologue:
Tnfrsf21
Mouse Description:
tumor necrosis factor receptor superfamily, member 21 Gene [Source:MGI Symbol;Acc:MGI:2151075]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa23765 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa23765
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000037855 Essential Splice Site 13 637 2 6
ENSDART00000130691 Essential Splice Site 28 652 2 6
Genomic Location:
Chromosome 20 (position 35856934)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTATATTGTCATAGTATAACAGTCTTCTTGTTGTTCTTTCATTGCTGTTA[G/A]CTGCTGCTTACTGTGGTCGGTGACGTCTTAACCCACACGCTGACCCCCAT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/eez1zj5l