kcnh6

Ensembl ID:
ENSDARG00000001803
ZFIN ID:
ZDB-GENE-040702-5
Description:
potassium voltage-gated channel, subfamily H (eag-related), member 2 [Source:RefSeq peptide;Acc:NP_
Human Orthologue:
KCNH6
Human Description:
potassium voltage-gated channel, subfamily H (eag-related), member 6 [Source:HGNC Symbol;Acc:18862]
Mouse Orthologue:
Kcnh6
Mouse Description:
potassium voltage-gated channel, subfamily H (eag-related), member 6 Gene [Source:MGI Symbol;Acc:MGI

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa17340 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa17340
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090809 Nonsense 1105 1186 16 16
ENSDART00000134201   None 772 None 10
Genomic Location (Zv9):
Chromosome 3 (position 31867024)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 31598334
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCTGTAATGATCAGCCGTGTTTTCCACAGAGTCCTGAYGTGGACAGCTKG[A/T]AAGAGAAGTCTCCWGACTCTCTGTCCAGCGGGATTCATCTGACGGTGGCT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link