irx2a

Ensembl ID:
ENSDARG00000001785
ZFIN ID:
ZDB-GENE-040426-1446
Description:
iroquois-class homeodomain protein IRX-2 [Source:RefSeq peptide;Acc:NP_957351]
Human Orthologue:
IRX2
Human Description:
iroquois homeobox 2 [Source:HGNC Symbol;Acc:14359]
Mouse Orthologue:
Irx2
Mouse Description:
Iroquois related homeobox 2 (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:1197526]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa17696 Essential Splice Site Available for shipment Available now
sa22736 Nonsense Mutation detected in F1 DNA During 2014
sa10776 Nonsense Available for shipment Available now
sa19128 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa17696
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000016303 Essential Splice Site 74 432 2 5
Genomic Location:
Chromosome 16 (position 568818)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAAAAACACAAATWCAAGAACATTTGACTGRCCCCGAATKTTATTTTTGA[A/G]GGGCYCTCCGTATGACGCGCACACTACGGGAATGGCAGGAGCCAYAAGTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22736
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000016303 Nonsense 159 432 2 5
Genomic Location:
Chromosome 16 (position 568561)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCATCACCAAAATGACCCTCACGCAAGTGTCCACCTGGTTCGCCAATGCA[C/T]GACGGAGACTCAAGAAGGAGAACAAGATGACCTGGGCACCGCGGAATAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10776
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000016303 Nonsense 260 432 3 5
Genomic Location:
Chromosome 16 (position 567751)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTGAAATCCAGGACAAATGCGAGGCGACGGATCTCGGGGAGGAAAGGCAG[C/T]GAGGCGCGTCACCCAAACCGGTGACCTCTTCTCCTYTGACCGGGGTGGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19128
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000016303 Nonsense 429 432 4 5
Genomic Location:
Chromosome 16 (position 566835)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTATTTCCTGCAGACCCCAGCGAGGTTTTCACAGTAAGATCCCAATCTTA[C/A]CTGTCGAGTTAAGACGAGGAAGATCTTCCAAGTAAGTCGCTAATTTGAGC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/ckik7ujg