prkacba

Ensembl ID:
ENSDARG00000001782
ZFIN ID:
ZDB-GENE-040426-1351
Description:
protein kinase, cAMP-dependent, catalytic, beta a [Source:RefSeq peptide;Acc:NP_957317]
Human Orthologue:
PRKACB
Human Description:
protein kinase, cAMP-dependent, catalytic, beta [Source:HGNC Symbol;Acc:9381]
Mouse Orthologue:
Prkacb
Mouse Description:
protein kinase, cAMP dependent, catalytic, beta Gene [Source:MGI Symbol;Acc:MGI:97594]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa31816 Nonsense Available for shipment Available now
sa15215 Nonsense Available for shipment Available now
sa21850 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa31816
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000011183 Nonsense 129 395 4 10
Genomic Location (Zv9):
Chromosome 11 (position 8285209)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 8129312
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTTTAGTTTTAATCCCATGTTTTATCATTTTTCAGGTGGTGAAGCTGAAA[C/T]AGATTGAACACACATTAAACGAGAAGAAAATATTACAAGCGGTCTCCTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15215
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000011183 Nonsense 241 395 7 10
Genomic Location (Zv9):
Chromosome 11 (position 8288260)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 8132363
KASP Assay ID:
2260-3948.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TKTTWAGGTAACAGATTTTGGATTTGCCAAAAGAGTCAAAGGCAGAACTT[G/A]GACATTGTGTGGAACACCAGAATACCTGGCACCAGAAATCATTCTCAGCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21850
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000011183 Nonsense 280 395 8 10
Genomic Location (Zv9):
Chromosome 11 (position 8289630)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 8133733
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTTGACTGGTGGGCACTGGGTGTTCTGATCTATGAAATGGCTGCTGGATA[T/A]CCGCCTTTCTTCGCTGATCAGCCTATTCAGATTTATGAGAAAATTGTGTC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link