si:dkey-21h14.7

Ensembl ID:
ENSDARG00000001781
ZFIN ID:
ZDB-GENE-041210-93
Description:
tetraspanin-11 [Source:RefSeq peptide;Acc:NP_001038502]
Human Orthologue:
TSPAN11
Human Description:
tetraspanin 11 [Source:HGNC Symbol;Acc:30795]
Mouse Orthologue:
Tspan11
Mouse Description:
tetraspanin 11 Gene [Source:MGI Symbol;Acc:MGI:1915748]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa40240 Essential Splice Site Mutation detected in F1 DNA During 2018
sa33406 Essential Splice Site Mutation detected in F1 DNA During 2018
sa33407 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa40240
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000023638 Essential Splice Site 29 254 None 7
ENSDART00000138661 Essential Splice Site 29 254 None 8
Genomic Location (Zv9):
Chromosome 4 (position 10240178)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 11176805
GRCz11 4 11175654
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CACGGTGTGTCTCAAATACCTGCTCTTTGTTTTCAACTTTCTCTTCTGGG[T/C]GAGTCTGAACTCCACTTTGCTGGTATAGCTCTTATCAAAAAGGAAGGAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33406
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000023638 Essential Splice Site 118 254 3 7
ENSDART00000138661 Essential Splice Site 118 254 4 8
Genomic Location (Zv9):
Chromosome 4 (position 10249673)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 11186300
GRCz11 4 11185149
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCTCATCGAGCTGGTGGCTGGAGTTCTGGCCTATGTGTATTATCAGGCGG[T/C]AAGTGAACTCTTTCCACAACACTGACACACAAAACAAAGCTCTTAAGAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33407
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000023638 Essential Splice Site 235 254 6 7
ENSDART00000138661 Essential Splice Site 235 254 7 8
Genomic Location (Zv9):
Chromosome 4 (position 10252366)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 11188993
GRCz11 4 11187842
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCACTTGCTTATCATTGGTGCTGTGGGAATAGGTGTGGCCTGTCTACAGG[T/A]AAGTCCCTCCCCCTTATGTAGATTATGAAATTAAAGGAATAGTTCACAGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link