nup155

Ensembl ID:
ENSDARG00000001777
ZFIN ID:
ZDB-GENE-040426-711
Description:
nuclear pore complex protein Nup155 [Source:RefSeq peptide;Acc:NP_956450]
Human Orthologue:
NUP155
Human Description:
nucleoporin 155kDa [Source:HGNC Symbol;Acc:8063]
Mouse Orthologue:
Nup155
Mouse Description:
nucleoporin 155 Gene [Source:MGI Symbol;Acc:MGI:2181182]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa18970 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa18970
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000010626 Essential Splice Site 968 1391 24 34
ENSDART00000137285 Essential Splice Site 700 1123 17 27
Genomic Location (Zv9):
Chromosome 10 (position 1633959)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 1579515
KASP Assay ID:
2260-2714.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACGGAGAGCCGGAGGAGGACACCAGCGGACAGCAGGCCTTTCAGGAGAGG[T/G]CAGTACACACACACACACTAACACACCAAGCTTCTGCTAAATGCGTTTGT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link