LOC563901

Ensembl ID:
ENSDARG00000001776
Human Orthologue:
STIM2
Human Description:
stromal interaction molecule 2 [Source:HGNC Symbol;Acc:19205]
Mouse Orthologue:
Stim2
Mouse Description:
stromal interaction molecule 2 Gene [Source:MGI Symbol;Acc:MGI:2151156]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa8291 Essential Splice Site Mutation detected in F1 DNA During 2014
sa8292 Splice Site, Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa8291
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000012089 Essential Splice Site 46 727 1 12
Genomic Location:
Chromosome 7 (position 62964291)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CATCTGGCGAACCGAGTCACTCCTGACCCAGCAGCTGTTGCTCCCACAGG[T/C]AAGACCCACTCAATCATAACAAATCGATSAANNCGCATCGTCTTCTTTAGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8292
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Splice Site, Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000012089 Splice Site, Nonsense 263 727 7 12
Genomic Location:
Chromosome 7 (position 63069238)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAACACTAGCATGTAGATGTGACTTAAACTGGTCTSTGGTGCYGTCAGGT[T/A]GGAAAAGGCTCARGAGGAGAACCGRACGGTGGCTGTGGAGAAGCAGAACC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/7kqdt7xf