otol1a

Ensembl ID:
ENSDARG00000001771
ZFIN ID:
ZDB-GENE-050707-1
Description:
Otolin-1-A [Source:UniProtKB/Swiss-Prot;Acc:A5PN28]
Human Orthologue:
OTOL1
Human Description:
otolin 1 homolog (zebrafish) [Source:HGNC Symbol;Acc:34071]
Mouse Orthologue:
Otol1
Mouse Description:
otolin 1 homolog (zebrafish) Gene [Source:MGI Symbol;Acc:MGI:2685260]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa16580 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa16580
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000019236 Essential Splice Site 195 489 3 4
ENSDART00000132859 Essential Splice Site 195 489 4 5
Genomic Location:
Chromosome 2 (position 5954109)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
RAGCGGGCTACCTGGGATTCCTGGAGTTACTGGGAAACAAGGAGAGAAAG[G/A]TGCATTTGTGATGAAAGATTTAACCCTGTATTTGATGCATCTTGTTATTG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/uxnvnpu6