ptpra

Ensembl ID:
ENSDARG00000001769
ZFIN IDs:
ZDB-GENE-020107-1, ZDB-GENE-020107-1, ZDB-GENE-020107-1
Description:
receptor-type tyrosine-protein phosphatase alpha [Source:RefSeq peptide;Acc:NP_571963]
Human Orthologue:
PTPRA
Human Description:
protein tyrosine phosphatase, receptor type, A [Source:HGNC Symbol;Acc:9664]
Mouse Orthologue:
Ptpra
Mouse Description:
protein tyrosine phosphatase, receptor type, A Gene [Source:MGI Symbol;Acc:MGI:97808]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa23893 Essential Splice Site Available for shipment Available now
sa14038 Nonsense Available for shipment Available now
sa10736 Essential Splice Site Available for shipment Available now
sa16696 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa23893
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000026903 Essential Splice Site 34 831 3 23
ENSDART00000101956 Essential Splice Site 34 829 3 22
ENSDART00000126872 Essential Splice Site 34 831 2 22
Genomic Location (Zv9):
Chromosome 21 (position 13993615)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 15694570
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGTGGCCTTTGTGGCCCTCAGCACGGCCCAGACTCTCCCTCACCTTTCAG[G/A]TAAGACACTTTTGCTTTGGTTTAGGCCCTTCCTCATTGCAAAAGCAAACT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14038
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000026903 Nonsense 129 831 4 23
ENSDART00000101956 Nonsense 129 829 4 22
ENSDART00000126872 Nonsense 129 831 3 22
Genomic Location (Zv9):
Chromosome 21 (position 13996134)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 15697089
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCCCAACTGCCGCATCCCCGTCTCTCACCACCAACMAAACTGGAGATCAC[C/T]AGACCACCGTTTTGGCTCCAGCAGGGACGCCAACGCCTGATCCCACATCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10736
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000026903 Essential Splice Site 172 831 4 23
ENSDART00000101956 Essential Splice Site 172 829 4 22
ENSDART00000126872 Essential Splice Site 172 831 3 22
Genomic Location (Zv9):
Chromosome 21 (position 13996267)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 15697222
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CMCGTATACCCCAGCTGATGCCACCACTGCTGACGTCAACAAGCCAGAAG[G/A]TACCATTCATCTGTTCTTTTCTTTTTACCATTTAAATKATTGATCGTCAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16696
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000026903 Essential Splice Site 624 831 18 23
ENSDART00000101956 Essential Splice Site 622 829 17 22
ENSDART00000126872 Essential Splice Site 624 831 17 22
Genomic Location (Zv9):
Chromosome 21 (position 14011973)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 15712928
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAAACGTGGAGAGGAGAACACKGATTACRTCAACGCCTCTTTTATAGATG[T/C]GAGTAAAACYTYAGCCAACATTTATTTCCAACTAMCCGAAGTACCAYTCA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link