tnxb

Ensembl ID:
ENSDARG00000001760
ZFIN ID:
ZDB-GENE-070103-5
Human Orthologue:
TNXB
Human Description:
tenascin XB [Source:HGNC Symbol;Acc:11976]
Mouse Orthologue:
Tnxb
Mouse Description:
tenascin XB Gene [Source:MGI Symbol;Acc:MGI:1932137]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa42693 Nonsense Mutation detected in F1 DNA During 2016
sa39089 Nonsense Mutation detected in F1 DNA During 2016
sa12917 Nonsense Available for shipment Available now
sa39088 Nonsense Mutation detected in F1 DNA During 2016
sa22795 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa42693
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000014439 Nonsense 623 2285 1 14
ENSDART00000132368   None 389 None 9
Genomic Location (Zv9):
Chromosome 16 (position 18689202)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 16738950
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCTCTTCAAAGCCTGAGGTGGACACCACACAGAAACCTGTCCAAAGTGTA[C/T]AAAACACAATTGGTGACAAGAAAAATTCTACCACTGAGTCTATAGTCAAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39089
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000014439 Nonsense 698 2285 1 14
ENSDART00000132368   None 389 None 9
Genomic Location (Zv9):
Chromosome 16 (position 18688977)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 16738725
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACACTGTCAAGAAACCTATCCAAAGTCTACAAAACAAAATTGGTGACAAG[A/T]AAAATTCTACTACTAAGTCAACAGTCAACACTATTAACATTCAGAAACCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12917
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000014439 Nonsense 1467 2285 3 14
ENSDART00000132368   None 389 None 9
Genomic Location (Zv9):
Chromosome 16 (position 18683927)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 16733671
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAACTGTGACTATGAAGATGTCCAGTGCCATGCCAGACMCAAAAACTGWC[A/T]AGACAAGGCCAGACAAGGCAATTTTAGTGAAAGAGACAGTTACAAAGGTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39088
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000014439 Nonsense 1608 2285 3 14
ENSDART00000132368   None 389 None 9
Genomic Location (Zv9):
Chromosome 16 (position 18683504)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 16733248
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TAACTCGGTCCAAGACAAAGATTACTACAAGAACTGCAGGAGATCAAGGG[G/T]AAGAAAGCAAGACCAATGCTGTCTCTGCTGAAAAAGACGAGAAGTTGTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22795
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000014439 Nonsense 1941 2285 7 14
ENSDART00000132368   None 389 None 9
Genomic Location (Zv9):
Chromosome 16 (position 18671716)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 16721515
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAGTGACTTTATCTGGCAGTTCTGTGGAGCACCAGCTTAGAGCACTTCAT[A/T]GATCTTCTTTATACATGGTGAAAATGACAAGTCAAGTCAACAGGCTCCAG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link