tnxb

Ensembl ID:
ENSDARG00000001760
ZFIN ID:
ZDB-GENE-070103-5
Human Orthologue:
TNXB
Human Description:
tenascin XB [Source:HGNC Symbol;Acc:11976]
Mouse Orthologue:
Tnxb
Mouse Description:
tenascin XB Gene [Source:MGI Symbol;Acc:MGI:1932137]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa12917 Nonsense Available for shipment Available now
sa22795 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa12917
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000014439 Nonsense 1467 2285 3 14
ENSDART00000132368 None None 389 None 9
Genomic Location:
Chromosome 16 (position 18683927)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAACTGTGACTATGAAGATGTCCAGTGCCATGCCAGACMCAAAAACTGWC[A/T]AGACAAGGCCAGACAAGGCAATTTTAGTGAAAGAGACAGTTACAAAGGTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22795
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000014439 Nonsense 1941 2285 7 14
ENSDART00000132368 None None 389 None 9
Genomic Location:
Chromosome 16 (position 18671716)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAGTGACTTTATCTGGCAGTTCTGTGGAGCACCAGCTTAGAGCACTTCAT[A/T]GATCTTCTTTATACATGGTGAAAATGACAAGTCAAGTCAACAGGCTCCAG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/iz4nyx4n