
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
tnxb
- Ensembl ID:
- ENSDARG00000001760
- ZFIN ID:
- ZDB-GENE-070103-5
- Human Orthologue:
- TNXB
- Human Description:
- tenascin XB [Source:HGNC Symbol;Acc:11976]
- Mouse Orthologue:
- Tnxb
- Mouse Description:
- tenascin XB Gene [Source:MGI Symbol;Acc:MGI:1932137]
Alleles
There are 5 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa42693 | Nonsense | Mutation detected in F1 DNA | During 2018 |
sa39089 | Nonsense | Mutation detected in F1 DNA | During 2018 |
sa12917 | Nonsense | Available for shipment | Available now |
sa39088 | Nonsense | Mutation detected in F1 DNA | During 2018 |
sa22795 | Nonsense | Available for shipment | Available now |
Mutation Details
- Allele Name:
- sa42693
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- C > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000014439 | Nonsense | 623 | 2285 | 1 | 14 |
ENSDART00000132368 | None | 389 | None | 9 |
- Genomic Location (Zv9):
- Chromosome 16 (position 18689202)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 16 16738950 GRCz11 16 16646927 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- CCTCTTCAAAGCCTGAGGTGGACACCACACAGAAACCTGTCCAAAGTGTA[C/T]AAAACACAATTGGTGACAAGAAAAATTCTACCACTGAGTCTATAGTCAAC
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa39089
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- A > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000014439 | Nonsense | 698 | 2285 | 1 | 14 |
ENSDART00000132368 | None | 389 | None | 9 |
- Genomic Location (Zv9):
- Chromosome 16 (position 18688977)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 16 16738725 GRCz11 16 16646702 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- ACACTGTCAAGAAACCTATCCAAAGTCTACAAAACAAAATTGGTGACAAG[A/T]AAAATTCTACTACTAAGTCAACAGTCAACACTATTAACATTCAGAAACCA
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa12917
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- A > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000014439 | Nonsense | 1467 | 2285 | 3 | 14 |
ENSDART00000132368 | None | 389 | None | 9 |
- Genomic Location (Zv9):
- Chromosome 16 (position 18683927)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 16 16733671 GRCz11 16 16641648 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- AAACTGTGACTATGAAGATGTCCAGTGCCATGCCAGACMCAAAAACTGWC[A/T]AGACAAGGCCAGACAAGGCAATTTTAGTGAAAGAGACAGTTACAAAGGTC
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa39088
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- G > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000014439 | Nonsense | 1608 | 2285 | 3 | 14 |
ENSDART00000132368 | None | 389 | None | 9 |
- Genomic Location (Zv9):
- Chromosome 16 (position 18683504)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 16 16733248 GRCz11 16 16641225 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TAACTCGGTCCAAGACAAAGATTACTACAAGAACTGCAGGAGATCAAGGG[G/T]AAGAAAGCAAGACCAATGCTGTCTCTGCTGAAAAAGACGAGAAGTTGTTT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa22795
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- A > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000014439 | Nonsense | 1941 | 2285 | 7 | 14 |
ENSDART00000132368 | None | 389 | None | 9 |
- Genomic Location (Zv9):
- Chromosome 16 (position 18671716)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 16 16721515 GRCz11 16 16629492 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- CAGTGACTTTATCTGGCAGTTCTGTGGAGCACCAGCTTAGAGCACTTCAT[A/T]GATCTTCTTTATACATGGTGAAAATGACAAGTCAAGTCAACAGGCTCCAG
- Associated Phenotype:
- Not determined
GWAS
This gene's human homologue has been identified in the following GWAS studies:
- Age-related macular degeneration: Genome-wide association study of age-related macular degeneration identifies associated variants in the TNXB-FKBPL-NOTCH4 region of chromosome 6p21.3. (View Study)
- HIV-1 control: Common genetic variation and the control of HIV-1 in humans. (View Study)
- Phospholipid levels (plasma): Genetic loci associated with plasma phospholipid n-3 fatty acids: a meta-analysis of genome-wide association studies from the CHARGE Consortium. (View Study)
- Systemic lupus erythematosus: Differential genetic associations for systemic lupus erythematosus based on anti-dsDNA autoantibody production. (View Study)
(GWAS data comes from http://www.genome.gov/gwastudies/.)
OMIM
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: