noc2l

Ensembl ID:
ENSDARG00000001754
ZFIN ID:
ZDB-GENE-000607-75
Description:
nucleolar complex protein 2 homolog [Source:RefSeq peptide;Acc:NP_001003830]
Human Orthologue:
NOC2L
Human Description:
nucleolar complex associated 2 homolog (S. cerevisiae) [Source:HGNC Symbol;Acc:24517]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa39407 Essential Splice Site Mutation detected in F1 DNA During 2017
sa13675 Nonsense Available for shipment Available now
sa32441 Nonsense Available for shipment Available now
sa29917 Essential Splice Site Mutation detected in F1 DNA During 2017
sa18365 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa39407
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000091662 Essential Splice Site 50 748 2 19
ENSDART00000122945 Essential Splice Site 50 744 2 19
ENSDART00000141853   None 187 None 6
Genomic Location (Zv9):
Chromosome 23 (position 23472481)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 23251788
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AACCCTCACCAAAGAAAGGAAAGAGCAAAACGCCTGCACTTCAGAAAACG[T/A]AAGCAAATGCTTTACATTCAGATGGTCATTCCAGTGTTCTGGGCCCAGTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13675
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000091662 Nonsense 241 748 7 19
ENSDART00000122945 Nonsense 237 744 7 19
ENSDART00000141853   None 187 None 6
Genomic Location (Zv9):
Chromosome 23 (position 23467286)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 23246593
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTTNATTTTAGATTAGTACTTCCATTTTCAAGTACCAGGTGGCAGAAAAAT[C/T]AGATTGATATTAAGATGTACCTTGCTGGTGTTGTTCAGGTATTTTTTTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32441
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000091662 Nonsense 413 748 11 19
ENSDART00000122945 Nonsense 409 744 11 19
ENSDART00000141853   None 187 None 6
Genomic Location (Zv9):
Chromosome 23 (position 23465098)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 23244405
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGTGTACAACTGGCAGTATGTGCACTGTCTATATCTGTGGTGTAGAGTGT[T/A]GAGCACTATTTACCCCAGTGAGGTTTTGGAGCCACTGATCTACCCACTGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa29917
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000091662 Essential Splice Site 633 748 16 19
ENSDART00000122945 Essential Splice Site 629 744 16 19
ENSDART00000141853 Essential Splice Site 134 187 4 6
Genomic Location (Zv9):
Chromosome 23 (position 23431989)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 23211296
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAAACTTCGGGAAAAGGAGATTCAGCTGGAAATCTCAGGAAAAGAAAGGG[T/G]AAAAAAAGCCAAATCCACAGCAATTATCAGGATTAAATCCAAATAATTCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18365
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000091662 Nonsense 724 748 19 19
ENSDART00000122945 Nonsense 720 744 19 19
ENSDART00000141853   None 187 None 6
Genomic Location (Zv9):
Chromosome 23 (position 23420918)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 23200225
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGACCRGAAGCAGCCTTCATCTTCTAAGGGCAAAGCTCCAAAGAAGATGT[T/A]GAGTACAGAGCTGAAACAGGTGGCTGAGGGAGATGAAGATATGGTTGAGG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link