fkbp8

Ensembl ID:
ENSDARG00000001734
ZFIN ID:
ZDB-GENE-040426-1849
Description:
peptidyl-prolyl cis-trans isomerase FKBP8 [Source:RefSeq peptide;Acc:NP_957178]
Human Orthologue:
FKBP8
Human Description:
FK506 binding protein 8, 38kDa [Source:HGNC Symbol;Acc:3724]
Mouse Orthologue:
Fkbp8
Mouse Description:
FK506 binding protein 8 Gene [Source:MGI Symbol;Acc:MGI:1341070]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa668 Nonsense F2 line generated During 2014

Mutation Details

Allele Name:
sa668
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000002029 Nonsense 267 406 6 9
Genomic Location:
Chromosome 22 (position 21255726)
KASP Assay ID:
554-0576.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GATATCAGTCAAGAAGAAGARGAAGAACTTTTGGACATGAAGGTRAARTG[T/A]CTGAACAATATGGCGGCTGCTCAGCTTAAGCTTGACCACTATGAAGCCGC
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/o10eh7af