si:ch211-198b21.4

Ensembl ID:
ENSDARG00000001733
ZFIN IDs:
ZDB-GENE-030616-21, ZDB-GENE-081104-508
Description:
PTB domain-containing engulfment adapter protein 1 [Source:UniProtKB/Swiss-Prot;Acc:Q32PV0]
Human Orthologue:
GULP1
Human Description:
GULP, engulfment adaptor PTB domain containing 1 [Source:HGNC Symbol;Acc:18649]
Mouse Orthologue:
Gulp1
Mouse Description:
GULP, engulfment adaptor PTB domain containing 1 Gene [Source:MGI Symbol;Acc:MGI:1920407]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa15770 Essential Splice Site Available for shipment Available now
sa15590 Essential Splice Site Available for shipment Available now
sa41508 Nonsense Mutation detected in F1 DNA During 2017
sa31740 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa15770
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000002027 Essential Splice Site None 300 None 11
ENSDART00000138133 Essential Splice Site None 375 None 12
Genomic Location (Zv9):
Chromosome 9 (position 43680303)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 42805473
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTTGGCAGGAGACACTGGCCGGTCYTTAGGAAATCTCCCCTCATTATTGG[T/A]AAGAATKTTGGCCNTTTTTTTTATATGGAGAGGTCTGACAGAAAGGACAGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15590
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000002027 Essential Splice Site 54 300 4 11
ENSDART00000138133 Essential Splice Site 54 375 4 12
Genomic Location (Zv9):
Chromosome 9 (position 43710826)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 42835996
KASP Assay ID:
2260-2283.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCAACCTAAAGRTACAGAGGTGGTGAAAGATGCCGTCAGAAAGCTCAAGG[T/C]TAGTTACTGCCGCTTCAGATTRCSTGAACACTGTTGGCAYCTTCATTTCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41508
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000002027 Nonsense 91 300 6 11
ENSDART00000138133 Nonsense 91 375 6 12
Genomic Location (Zv9):
Chromosome 9 (position 43712281)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 42837451
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCCATGACTTCTTTTCTAATCTTGTTTTCTTATTCAAAGGAAGTGCAGTA[C/A]AACTGTCAGCTCCACCGGATATCCTTCTGTGCAGATGATAAGACAGACAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31740
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000002027 Essential Splice Site 246 300 9 11
ENSDART00000138133 Essential Splice Site 321 375 10 12
Genomic Location (Zv9):
Chromosome 9 (position 43717761)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 42842931
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCAAGTAATGGCTCGGCCCCTCCACCCCCGGCAAGACCTACAGAGATTAG[T/A]GAGTTCTCTTTCTTTTTCTTTGCCAGCATTTGAGAAATGTTGCTTATTCC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link