oc90

Ensembl ID:
ENSDARG00000001721
ZFIN ID:
ZDB-GENE-070912-300
Description:
otoconin 90 [Source:RefSeq peptide;Acc:NP_001073661]
Human Orthologue:
AC100868.1
Human Description:
Otoconin-90 [Source:UniProtKB/Swiss-Prot;Acc:Q02509]
Mouse Orthologue:
Oc90
Mouse Description:
otoconin 90 Gene [Source:MGI Symbol;Acc:MGI:1313269]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa33001 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa33001
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000098303 Nonsense 149 939 5 15
ENSDART00000139945 Nonsense 57 159 3 6
ENSDART00000144317 Nonsense 14 82 3 6
Genomic Location (Zv9):
Chromosome 2 (position 43057341)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 43106805
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTTTTGCAGATATGTTGGATTTCTGTGATGAAGGATTCTGTCGGTGTGAT[C/T]GAATGGTTATAGACTGCATCAGCTTCAACCGTCCAATCACAAAACAGGAC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link