LOC796753

Ensembl ID:
ENSDARG00000001712
Human Orthologues:
KCNMB1, KCNMB2
Human Descriptions:
potassium large conductance calcium-activated channel, subfamily M, beta member 1 [Source:HGNC Symbo
potassium large conductance calcium-activated channel, subfamily M, beta member 2 [Source:HGNC Symbo
Mouse Orthologues:
Kcnmb1, Kcnmb2
Mouse Descriptions:
potassium large conductance calcium-activated channel, subfamily M, beta member 1 Gene [Source:MGI S
potassium large conductance calcium-activated channel, subfamily M, beta member 2 Gene [Source:MGI S

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa35026 Nonsense Mutation detected in F1 DNA During 2016
sa35025 Essential Splice Site Mutation detected in F1 DNA During 2016
sa21852 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa35026
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000052698 Nonsense 31 234 2 4
Genomic Location (Zv9):
Chromosome 11 (position 8398851)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 8306758
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTGTCCCTTAAGCAGGACGATTTATCAGAAGATTCGAGAGTATGATATTT[T/A]GGAGAAGAGGAGGACGGTGACCGCGCTGAAGGCTGGAGAGGACAGAGCCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35025
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000052698 Essential Splice Site 141 234 4 4
Genomic Location (Zv9):
Chromosome 11 (position 8389150)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 8297057
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAATTTAAGGCAGCAAGCATTATTTACAGTGGATTTCTTTCTTCCCCTGC[A/T]GTGTTTTTACATCCCAAAGTGCCGAAAGGAGCAAACACTAATGCACACCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21852
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000052698 Nonsense 190 234 4 4
Genomic Location (Zv9):
Chromosome 11 (position 8388999)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 8296906
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TATTATGACCCCTCAGAGCAGCAGGACGGCGTACTTCTGACACGTCTCTA[C/A]GGCCGCGGAGCGATCATCAGCTCGCTCCTTTGGCCCACATGCACCCTTGT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link