gpm6bb

Ensembl ID:
ENSDARG00000001676
ZFIN ID:
ZDB-GENE-030710-10
Description:
glycoprotein M6Bb [Source:RefSeq peptide;Acc:NP_001013352]
Human Orthologue:
GPM6B
Human Description:
glycoprotein M6B [Source:HGNC Symbol;Acc:4461]
Mouse Orthologue:
Gpm6b
Mouse Description:
glycoprotein m6b Gene [Source:MGI Symbol;Acc:MGI:107672]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa34793 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa34793
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085693   None 268 None 7
ENSDART00000123319 Nonsense 31 332 1 8
ENSDART00000130963   None 268 None 8
ENSDART00000137214   None 57 None 3
Genomic Location (Zv9):
Chromosome 9 (position 56842898)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 55250712
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTGTGCAGGGGGCGGGGCGAGGGTAATCCCTGCCGCTGACGTCACACGCT[C/A]GTGCACCTCCTCATCAGAGCGGCGCGGGAGTGAGCGAGTGTCAGTCAGTC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link