echs1

Ensembl ID:
ENSDARG00000001578
ZFIN ID:
ZDB-GENE-030616-617
Description:
enoyl-CoA hydratase, mitochondrial [Source:RefSeq peptide;Acc:NP_001004529]
Human Orthologue:
ECHS1
Human Description:
enoyl CoA hydratase, short chain, 1, mitochondrial [Source:HGNC Symbol;Acc:3151]
Mouse Orthologue:
Echs1
Mouse Description:
enoyl Coenzyme A hydratase, short chain, 1, mitochondrial Gene [Source:MGI Symbol;Acc:MGI:2136460]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa22292 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa22292
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000001830 Essential Splice Site 97 291 3 8
Genomic Location:
Chromosome 13 (position 24804533)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGTATTGAACTGATTTGAAACTGTTGTTGTGTGTTTTATCTGCTTTGATA[G/A]CTGGTGCTGACATTAAAGAGATGCAGAATCGAACCTTCCAAGAGTGTTAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/km4a9tav