si:ch211-46o5.1

Ensembl ID:
ENSDARG00000001559
ZFIN IDs:
ZDB-GENE-030616-39, ZDB-GENE-060503-890
Description:
Novel protein similar to vertebrate CUB and Sushi multiple domain containing protein family [Source:
Human Orthologue:
CSMD2
Human Description:
CUB and Sushi multiple domains 2 [Source:HGNC Symbol;Acc:19290]
Mouse Orthologue:
Csmd2
Mouse Description:
CUB and Sushi multiple domains 2 Gene [Source:MGI Symbol;Acc:MGI:2386401]

Alleles

There are 11 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa43322 Essential Splice Site Mutation detected in F1 DNA During 2017
sa8421 Essential Splice Site Mutation detected in F1 DNA During 2017
sa29241 Essential Splice Site Mutation detected in F1 DNA During 2017
sa36884 Nonsense Mutation detected in F1 DNA During 2017
sa10968 Essential Splice Site Available for shipment Available now
sa9832 Nonsense Available for shipment Available now
sa36883 Essential Splice Site Mutation detected in F1 DNA During 2017
sa11417 Essential Splice Site Available for shipment Available now
sa43321 Essential Splice Site Mutation detected in F1 DNA During 2017
sa36882 Essential Splice Site Available for shipment Available now
sa15257 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa43322
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000001805 Essential Splice Site 172 3604 4 70
ENSDART00000132471 Essential Splice Site 39 3456 2 68
Genomic Location (Zv9):
Chromosome 19 (position 38064716)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 36929236
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGTTTCAATTACTTAATAAATAATAATTTTTTCTCTGTCACTTCATTTTA[G/T]CTCTTCCAAGCTACACATGTGGAAATCCAGGCCAGCTGCTCAACGGCATG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8421
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000001805 Essential Splice Site 399 3604 8 70
ENSDART00000132471 Essential Splice Site 266 3456 6 68
Genomic Location (Zv9):
Chromosome 19 (position 37964211)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 36828731
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAGATCCAGGAATCCCGGAGAGGGGCAAAAGAAAAGGCTCTGATTTCAGG[T/C]GAGAAATGAGTTTATGGATTACTTATTAAAATAGTCCACTGAGAGGACAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa29241
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000001805 Essential Splice Site 441 3604 9 70
ENSDART00000132471 Essential Splice Site 308 3456 7 68
Genomic Location (Zv9):
Chromosome 19 (position 37957349)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 36821869
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTTACAGACAGTTATGTTGGATGGAGTGATGACCGGCCGATCTGCAGAGG[T/C]AGGACTCTAAAAAAAAAAAAATCTTATTTTATTTTTAATTTGCAATAATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36884
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000001805 Nonsense 951 3604 18 70
ENSDART00000132471 Nonsense 818 3456 16 68
Genomic Location (Zv9):
Chromosome 19 (position 37911485)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 36776005
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCGGATACACTCTCAGTGACCACGAGCCCCTCGAATGTGAACCAAACTTC[C/T]AGTGGAGTCGCCCCCTGCCCAGCTGCGATGGTACAGTCCACCCTTTACCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10968
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000001805 Essential Splice Site 961 3604 18 70
ENSDART00000132471 Essential Splice Site 828 3456 16 68
Genomic Location (Zv9):
Chromosome 19 (position 37911453)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 36775973
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAATGTGAACCAAACTTCCAGTGGAGTCGCCCCCTGCCCAGCTGCGATGG[T/C]ACAGTCCACYCTTTACCACCCAAAAAACAGGCACTAGCAGGGAAAAGGAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9832
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000001805 Nonsense 1010 3604 20 70
ENSDART00000132471 Nonsense 877 3456 18 68
Genomic Location (Zv9):
Chromosome 19 (position 37904318)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 36768838
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTTCCTCTCGATCTCCACAGGAGTYCAGTTTACCTTCCACACCTTTCACT[T/A]GGAGAGTCCTCACGACCACCTTTTAGTTACAGAAAATGGTAGTTTTTCTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36883
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000001805 Essential Splice Site 1071 3604 20 70
ENSDART00000132471 Essential Splice Site 938 3456 18 68
Genomic Location (Zv9):
Chromosome 19 (position 37904132)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 36768652
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCTCTCTGACTTCTCTGTTTCCTACGAGGGCTTTAATATCACTTTTTCAG[G/A]TACAGGGCTTTCTGATTTTTATAACAACTAGATCAGATTTTATTTATTTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11417
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000001805 Essential Splice Site 2177 3604 42 70
ENSDART00000132471 Essential Splice Site 2029 3456 40 68
Genomic Location (Zv9):
Chromosome 19 (position 37771389)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 36635909
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAACAYGGCACGACGCGCAACTGGGATCATYCGTTTCCTCGCTGTGAAGG[T/C]ACGACCCTCTTTATTTCSTCCCCCACTTCAGTAAACATCTGCTGTGCTTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43321
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000001805 Essential Splice Site 2284 3604 44 70
ENSDART00000132471 Essential Splice Site 2136 3456 42 68
Genomic Location (Zv9):
Chromosome 19 (position 37766106)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 36630626
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTCCGAAGCAGTTCTGAGAAAGGGGGGTTGTTCAAGATCAACTACCAAG[G/A]TAATTTGTTTAAAGGAAAGCTACCATTAGCATTTCAATTCATTCCAAAAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36882
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000001805 Essential Splice Site 2768 3604 53 70
ENSDART00000132471 Essential Splice Site 2620 3456 51 68
Genomic Location (Zv9):
Chromosome 19 (position 37716245)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 36580765
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATCTGTGAGCAGGACCACCGCTGGTCCGGGAAGACTCCTGTCTGTATCCG[T/C]AAGTGTTGCTTAAGCAGCAACTCTCTTATCTGAGGTCTTTTGACAGTTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15257
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000001805 Essential Splice Site 3008 3604 57 70
ENSDART00000132471 Essential Splice Site 2860 3456 55 68
Genomic Location (Zv9):
Chromosome 19 (position 37701249)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 36565769
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACCTGTCTGGCTAAYGGGAGCTGGGTGGRCATCCAGCCYGAATGCCACGR[T/A]AAGAAATATGAANCGCCATGCGCAGCTGAACGTACATGATTWATCGCTTC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link