kifc1

Ensembl ID:
ENSDARG00000001558
ZFIN ID:
ZDB-GENE-000208-21
Description:
kinesin family member C1-like [Source:RefSeq peptide;Acc:NP_001038419]
Human Orthologue:
KIFC1
Human Description:
kinesin family member C1 [Source:HGNC Symbol;Acc:6389]
Mouse Orthologues:
Kifc1, Kifc5b
Mouse Descriptions:
kinesin family member C1 Gene [Source:MGI Symbol;Acc:MGI:109596]
kinesin family member C5B Gene [Source:MGI Symbol;Acc:MGI:2137414]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa23434 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa23434
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000001804 Nonsense 120 618 7 17
Genomic Location (Zv9):
Chromosome 19 (position 7616182)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 7074721
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGGGACCTGAAAGGCAAAGTCAGCGACATGGAGGCCAAAGTTCAGAACTA[T/G]CAGAGCAAAGTAAAAACTGTAAATCAGGAAAACGAGTGTCTGAAAGACTC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link