tomm34

Ensembl ID:
ENSDARG00000001557
ZFIN ID:
ZDB-GENE-030131-2081
Description:
mitochondrial import receptor subunit TOM34 [Source:RefSeq peptide;Acc:NP_955932]
Human Orthologue:
TOMM34
Human Description:
translocase of outer mitochondrial membrane 34 [Source:HGNC Symbol;Acc:15746]
Mouse Orthologue:
Tomm34
Mouse Description:
translocase of outer mitochondrial membrane 34 Gene [Source:MGI Symbol;Acc:MGI:1914395]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa2296 Essential Splice Site F2 line generated During 2014

Mutation Details

Allele Name:
sa2296
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000001803 Essential Splice Site 44 305 2 8

The following transcripts of ENSDARG00000001557 do not overlap with this mutation:

Genomic Location:
Chromosome 6 (position 52184998)
KASP Assay ID:
554-2697.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAAGCGGTGACCCTCTACAGCCAKGCCATCCAGCAGCTGGAGAAATCTGG[T/C]AAGAGGTCTCAGATATTACATATATTGCTTGGGTGAATATCATCCTTACA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/5sei9z1d