adam8a

Ensembl ID:
ENSDARG00000001452
ZFIN ID:
ZDB-GENE-030616-622
Description:
a disintegrin and metalloproteinase domain 8a [Source:RefSeq peptide;Acc:NP_956931]
Mouse Orthologue:
Adam8
Mouse Description:
a disintegrin and metallopeptidase domain 8 Gene [Source:MGI Symbol;Acc:MGI:107825]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa22294 Nonsense Mutation detected in F1 DNA During 2014
sa12984 Essential Splice Site Available for shipment Available now
sa12999 Essential Splice Site Available for shipment Available now
sa22295 Essential Splice Site Mutation detected in F1 DNA During 2014
sa10470 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa22294
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000001678 Nonsense 57 843 3 25

The following transcripts of ENSDARG00000001452 do not overlap with this mutation:

Genomic Location:
Chromosome 13 (position 24895772)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CATGCTTGCTTGCTTTGATTTATTTAGAAATATCCTGAGCAACTTGAATA[T/A]GATGTGGCTATAGATGGGAGAAACTTGACAATATCTTTGCACAGAAATAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12984
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000001678 Essential Splice Site 126 843 5 25
ENSDART00000001678 Essential Splice Site 126 843 5 25

The following transcripts of ENSDARG00000001452 do not overlap with this mutation:

Genomic Location:
Chromosome 13 (position 24896161)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATAAWTTTGAAGATTCYTCAGTCAGCRTGGSACTTTGTTCTGGAATGGAG[T/G]AAGAAAAATKAAATATTMAGCAACTTTTGAAAAGAATAGATTGAACATCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12999
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000001678 Essential Splice Site 126 843 5 25
ENSDART00000001678 Essential Splice Site 126 843 5 25

The following transcripts of ENSDARG00000001452 do not overlap with this mutation:

Genomic Location:
Chromosome 13 (position 24896161)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATAAWTTTGAAGATTCYTCAGTCAGCRTGGSACTTTGTTCTGGAATGGAG[T/G]AAGAAAAATKAAATATTMAGCAACTTTTGAAAAGAATAGATTGAACATCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22295
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000001678 Essential Splice Site 596 843 None 25

The following transcripts of ENSDARG00000001452 do not overlap with this mutation:

Genomic Location:
Chromosome 13 (position 24900372)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGACAAAAGCTTTATTTATTCATTTATTTCCAATATATTTTTCAATCAAC[A/G]GGTGTGTTACAAAAGCCTTTGCCTCGATATCAGTATGTACGGCACTGAGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10470
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000001678 Nonsense 685 843 19 25

The following transcripts of ENSDARG00000001452 do not overlap with this mutation:

Genomic Location:
Chromosome 13 (position 24900963)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCATTATTATTGGAGCGCTGGTGTATAACAGAAACAAAATAACAGAATTT[A/T]GAAAGAAAAGGTAAGACGTCTTATTGATTTCTGTGATCATTCATTTATGG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/cmflq97p