inppl1b

Ensembl ID:
ENSDARG00000001442
ZFIN IDs:
ZDB-GENE-030616-75, ZDB-GENE-030616-75
Description:
Phosphatidylinositol-3,4,5-trisphosphate 5-phosphatase 2B [Source:UniProtKB/Swiss-Prot;Acc:Q2I6J0]
Human Orthologue:
INPPL1
Human Description:
inositol polyphosphate phosphatase-like 1 [Source:HGNC Symbol;Acc:6080]
Mouse Orthologue:
Inppl1
Mouse Description:
inositol polyphosphate phosphatase-like 1 Gene [Source:MGI Symbol;Acc:MGI:1333787]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa22511 Essential Splice Site Available for shipment Available now
sa22512 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa22511
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000044884 Essential Splice Site 67 1077 2 23
ENSDART00000105745 Essential Splice Site 67 1226 2 27
Genomic Location (Zv9):
Chromosome 14 (position 33625303)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 32478111
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTCACACCTATCGAATTCTCCCTGATGCAGATGGATTATTGGCTGTGCAG[G/A]TGAGACAAATAAGTTTGCATGGTCAGAAGTACACTAAGAAAGCATATGTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22512
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000044884 Essential Splice Site 264 1077 7 23
ENSDART00000105745 Essential Splice Site 413 1226 11 27
Genomic Location (Zv9):
Chromosome 14 (position 33632853)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 32470565
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAAGTCTGAGCTGGACGTCATTTCTGTGTTTGTGGGCACCTGGAATATGG[G/A]TATCAAGATGCACTTCACTGAATTTTGCAAAAATATAAAAACTTGCTATT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link