actn3b

Ensembl ID:
ENSDARG00000001431
ZFIN ID:
ZDB-GENE-030131-2040
Description:
actinin alpha 3b [Source:RefSeq peptide;Acc:NP_991107]
Mouse Orthologue:
Actn3
Mouse Description:
actinin alpha 3 Gene [Source:MGI Symbol;Acc:MGI:99678]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa20858 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa20858
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000001649 Nonsense 8 898 1 21

The following transcripts of ENSDARG00000001431 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 7 (position 7866570)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATAAGGGTTAGAGGGATAGGTGTGAAAAGATGACGGCTGTTGTCGAGACG[C/T]AAATGCAGTATAACAACACCTACATGATGTCTACTACGCAAGACTACATG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link