actn3b

Ensembl ID:
ENSDARG00000001431
ZFIN ID:
ZDB-GENE-030131-2040
Description:
actinin alpha 3b [Source:RefSeq peptide;Acc:NP_991107]
Mouse Orthologue:
Actn3
Mouse Description:
actinin alpha 3 Gene [Source:MGI Symbol;Acc:MGI:99678]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa20858 Nonsense Mutation detected in F1 DNA During 2014
sa8257 Nonsense Mutation detected in F1 DNA During 2014
sa2392 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa20858
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000001649 Nonsense 8 898 1 21

The following transcripts of ENSDARG00000001431 do not overlap with this mutation:

Genomic Location:
Chromosome 7 (position 7866570)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATAAGGGTTAGAGGGATAGGTGTGAAAAGATGACGGCTGTTGTCGAGACG[C/T]AAATGCAGTATAACAACACCTACATGATGTCTACTACGCAAGACTACATG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8257
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000001649 Nonsense 264 898 8 21

The following transcripts of ENSDARG00000001431 do not overlap with this mutation:

Genomic Location:
Chromosome 7 (position 7920757)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAGCCATCATGACCTACGTGTCCTGCTTTTACCATGCTTTCGCTGGTGCT[G/T]AACAGGTAAAAATGAYYACRNNNNNNNNTTATTCWGAATTCAGTTTCACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa2392
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000001649 Nonsense 574 898 15 21

The following transcripts of ENSDARG00000001431 do not overlap with this mutation:

Genomic Location:
Chromosome 7 (position 7947659)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTCTGATCACAGCTCACGACCAGTTTAAAGCCACTCTTCCCGAGGCYGAT[A/T]AGGAGCGAATGGCCGTGATGGGCAYCCAGAACGAGATCGTGAAGATYGCT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/3m0rbn4v