si:ch211-214d15.1

Ensembl ID:
ENSDARG00000001414
ZFIN ID:
ZDB-GENE-040724-63
Description:
Novel protein [Source:UniProtKB/TrEMBL;Acc:Q7SZV6]
Human Orthologue:
MCTP2
Human Description:
multiple C2 domains, transmembrane 2 [Source:HGNC Symbol;Acc:25636]
Mouse Orthologue:
Mctp2
Mouse Description:
multiple C2 domains, transmembrane 2 Gene [Source:MGI Symbol;Acc:MGI:2685335]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa16716 Nonsense Available for shipment Available now
sa19203 Essential Splice Site Mutation detected in F1 DNA During 2017
sa13733 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa16716
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000001102 Nonsense 224 927 2 22
ENSDART00000136489   None 422 None 12
Genomic Location (Zv9):
Chromosome 18 (position 23157584)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 23387807
KASP Assay ID:
2261-2225.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTCAGGACACTCCTAATGAAACCAGTGACTTTGATGATCTSTCAGAACAT[G/T]AACGAAAYGTGAGTATTTTTRAAAGAAAATGTACTTTTAGACATTATCRT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19203
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000001102 Essential Splice Site 375 927 7 22
ENSDART00000136489   None 422 None 12
Genomic Location (Zv9):
Chromosome 18 (position 23177913)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 23408136
KASP Assay ID:
2261-2226.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTCAAATCAAAGTCAAACGATCTAACATCTTTTTTTTTTAATCATTTTTT[A/G]GAAGTGGCTCCTAAGAAGAAAGGGATCCTTCAATAAGGTTTGTCTTGAGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13733
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000001102 Essential Splice Site 799 927 18 22
ENSDART00000136489 Essential Splice Site 316 422 9 12
Genomic Location (Zv9):
Chromosome 18 (position 23220187)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 23450410
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTTTGCAGGAGCACATGTCGGTGGCTGAGGACGAGGACGAGGATGAAAAG[G/A]TATTCCGCCGGTGTCATGCCTGCTTTTTTGATTAACCGCTGACTTTTATA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link