g2e3

Ensembl ID:
ENSDARG00000001313
ZFIN ID:
ZDB-GENE-030616-400
Description:
G2/M phase-specific E3 ubiquitin-protein ligase [Source:RefSeq peptide;Acc:NP_001003822]
Human Orthologue:
G2E3
Human Description:
G2/M-phase specific E3 ubiquitin protein ligase [Source:HGNC Symbol;Acc:20338]
Mouse Orthologue:
G2e3
Mouse Description:
G2/M-phase specific E3 ubiquitin ligase Gene [Source:MGI Symbol;Acc:MGI:2444298]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa17201 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa17201
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000001444 Nonsense 314 706 9 14

The following transcripts of ENSDARG00000001313 do not overlap with this mutation:

Genomic Location:
Chromosome 17 (position 28865470)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAGCMTCATTGCCATTGCCAAATCATGTTGAATCGCCACTGGCTATAAGA[C/T]AAGAGAGGAAGAGGCTGTTTAAATCGATCTCTGACATTCACTCTTCAATC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/eyyl44y6