pcgf1

Ensembl ID:
ENSDARG00000001249
ZFIN ID:
ZDB-GENE-030616-605
Description:
Polycomb group RING finger protein 1 [Source:UniProtKB/Swiss-Prot;Acc:Q7ZYZ7]
Human Orthologue:
PCGF1
Human Description:
polycomb group ring finger 1 [Source:HGNC Symbol;Acc:17615]
Mouse Orthologue:
Pcgf1
Mouse Description:
polycomb group ring finger 1 Gene [Source:MGI Symbol;Acc:MGI:1917087]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa22415 Nonsense Available for shipment Available now
sa30672 Essential Splice Site Mutation detected in F1 DNA During 2017
sa18212 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa22415
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000001424 Nonsense 107 261 3 9
ENSDART00000129432 Nonsense 141 295 3 9
Genomic Location (Zv9):
Chromosome 14 (position 5407347)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 5094344
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAGCCGCTGCTGAATCTGAAGTTGGACAGAGTCATGCAGGACATCGTCTA[T/A]AAATTGGTTCCAGGTCTACAGGAGAGTGAGTACAGAGAAGTGGAAGGTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa30672
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000001424 Essential Splice Site 175 261 5 9
ENSDART00000129432 Essential Splice Site 209 295 5 9
Genomic Location (Zv9):
Chromosome 14 (position 5406947)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 5093944
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACTTCTACAGATATGATGAGCAGGTCTCTTTATGTCTGGAAAGACAAAGG[T/C]AAGCCGACAACAATTTATTTTTACATCACTGTTCAAAACTCTGAGGTTGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18212
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000001424 Nonsense 195 261 7 9
ENSDART00000129432 Nonsense 229 295 7 9
Genomic Location (Zv9):
Chromosome 14 (position 5405376)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 5092373
KASP Assay ID:
2260-7221.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GACGATGCATTTTCATGTTTTCYATTTCCGCAGCAGAAATTTGTACGTTG[T/A]TCAGTCAGGGCGGAAGTACGGCATTTGAGGAARGTGTTATGTCATCGACT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link