puf60b

Ensembl ID:
ENSDARG00000001241
ZFIN ID:
ZDB-GENE-040625-116
Description:
Poly(U)-binding-splicing factor PUF60-B [Source:UniProtKB/Swiss-Prot;Acc:Q6IQE0]
Human Orthologue:
PUF60
Human Description:
poly-U binding splicing factor 60KDa [Source:HGNC Symbol;Acc:17042]
Mouse Orthologue:
Puf60
Mouse Description:
poly-U binding splicing factor 60 Gene [Source:MGI Symbol;Acc:MGI:1915209]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa13888 Nonsense Available for shipment Available now
sa18886 Nonsense Mutation detected in F1 DNA During 2017
sa9413 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa13888
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000038487 Nonsense 21 516 3 12
ENSDART00000052274 Nonsense 21 502 3 11
ENSDART00000143285 Nonsense 21 499 3 11
Genomic Location (Zv9):
Chromosome 7 (position 43877681)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 40867981
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GACAAGGCACAGGGTCAAAGCTTGGATTACCGCCTCTTACTCCTGAGCAA[C/T]AGGAGGCGCTACAGAAGGTAAATAGTAGATCTTTKTTTTWCTTTAATTCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18886
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000038487 Nonsense 382 516 11 12
ENSDART00000052274 Nonsense 368 502 10 11
ENSDART00000143285 Nonsense 365 499 10 11
ENSDART00000038487 Nonsense 382 516 11 12
ENSDART00000052274 Nonsense 368 502 10 11
ENSDART00000143285 Nonsense 365 499 10 11
Genomic Location (Zv9):
Chromosome 7 (position 43886658)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 40876958
KASP Assay ID:
554-6149.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CATCTGCAGTGCAATTGCACACAGAAGTGAAGAGAGAGGAAGACAGCAGG[C/T]GAACTGCAGAAGATCACAGTGCACCGGTTGGCAATGGACAAGACAGTGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9413
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000038487 Nonsense 382 516 11 12
ENSDART00000052274 Nonsense 368 502 10 11
ENSDART00000143285 Nonsense 365 499 10 11
ENSDART00000038487 Nonsense 382 516 11 12
ENSDART00000052274 Nonsense 368 502 10 11
ENSDART00000143285 Nonsense 365 499 10 11
Genomic Location (Zv9):
Chromosome 7 (position 43886658)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 40876958
KASP Assay ID:
554-6149.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CATCTGCAGTGCAATTGCACACAGAAGTGAAGAGAGAGGAAGACAGCAGG[C/T]GAACTGCAGAAGATCACAGTGCACCGGTTGGCAATGGACAAGACAGTGAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link