map4k2l

Ensembl ID:
ENSDARG00000001234
ZFIN ID:
ZDB-GENE-030616-163
Description:
mitogen-activated protein kinase kinase kinase kinase 2-like [Source:RefSeq peptide;Acc:NP_00103544
Human Orthologue:
MAP4K2
Human Description:
mitogen-activated protein kinase kinase kinase kinase 2 [Source:HGNC Symbol;Acc:6864]
Mouse Orthologue:
Map4k2
Mouse Description:
mitogen-activated protein kinase kinase kinase kinase 2 Gene [Source:MGI Symbol;Acc:MGI:1346883]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa26915 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa26915
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000009367 Nonsense 352 865 15 32
Genomic Location (Zv9):
Chromosome 7 (position 18844395)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 17411917
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TACAAATTTCACAGGAGGGCTAATAACTGTATATGTCCGTCATTAGGGAT[C/A]ATGTGATGATTGGAGCATATCTGGAGATGAACCCGAGTCACCGTAAGTGC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Urate levels: Genome-wide association study for serum urate concentrations and gout among African Americans identifies genomic risk loci and a novel URAT1 loss-of-function allele. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link