mycbp2

Ensembl ID:
ENSDARG00000001220
ZFIN ID:
ZDB-GENE-030616-132
Description:
probable E3 ubiquitin-protein ligase MYCBP2 [Source:RefSeq peptide;Acc:NP_001012247]
Human Orthologue:
MYCBP2
Human Description:
MYC binding protein 2 [Source:HGNC Symbol;Acc:23386]
Mouse Orthologue:
Mycbp2
Mouse Description:
MYC binding protein 2 Gene [Source:MGI Symbol;Acc:MGI:2179432]

Alleles

There are 6 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa34597 Nonsense Mutation detected in F1 DNA During 2016
sa21455 Essential Splice Site Mutation detected in F1 DNA During 2016
sa27372 Essential Splice Site Mutation detected in F1 DNA During 2016
sa17311 Nonsense Available for shipment Available now
sa25421 Nonsense Mutation detected in F1 DNA During 2016
sa41386 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa34597
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000039157 Nonsense 106 4574 2 82
ENSDART00000044835   None 3118 2 83
ENSDART00000124901 Nonsense 106 4648 2 83
ENSDART00000126745   None 631 2 81
Genomic Location (Zv9):
Chromosome 9 (position 17797055)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 17273125
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTGTTTCAGGGGGAAGAAAGCTTTGAGCAAGAAGAAGCTAAAAAGGAGG[C/T]AAAAAGTCAAATCAAAAGTAAAAACAAGAACAAAGGTAAGACTGTCAATA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21455
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000039157 Essential Splice Site 388 4574 None 82
ENSDART00000044835 Essential Splice Site None 3118 None 83
ENSDART00000124901 Essential Splice Site 388 4648 None 83
ENSDART00000126745 Essential Splice Site None 631 None 81
Genomic Location (Zv9):
Chromosome 9 (position 17736413)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 17212483
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTTGTTCATCATTGTGTTTGTGTGGGTGCTAATAACAGTCTATTGATTCC[A/T]GGGCCATGTATACAACTCCACATCACGTATCAGGAACCGTAAGGAGAAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa27372
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000039157 Essential Splice Site 1871 4574 None 82
ENSDART00000044835 Essential Splice Site 1464 3118 None 83
ENSDART00000124901 Essential Splice Site 1871 4648 None 83
ENSDART00000126745 Essential Splice Site None 631 None 81
Genomic Location (Zv9):
Chromosome 9 (position 17655246)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 17131316
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATGGCACCAATCAGACCAGAGGCCAGATCCCTCAGATTCTTTATTACAGG[T/A]CTGTACTTCAGATAACATCATTTATTAGAGATGCTGCCTATTATTAACTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17311
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000039157 Nonsense 2720 4574 55 82
ENSDART00000044835 Nonsense 2431 3118 56 83
ENSDART00000124901 Nonsense 2794 4648 56 83
ENSDART00000126745   None 631 54 81
Genomic Location (Zv9):
Chromosome 9 (position 17600587)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 17076657
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTGAKGGCAGAACCTCAGGAYTTAGGGCTGAGTCTCCAAACCCTGGCTCC[C/T]GATCCTCCTCACCAAAACAAAAGACCTTCACTTCAGGGAGATCTAGCCCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa25421
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000039157 Nonsense 3879 4574 69 82
ENSDART00000044835   None 3118 70 83
ENSDART00000124901 Nonsense 3953 4648 70 83
ENSDART00000126745   None 631 68 81
Genomic Location (Zv9):
Chromosome 9 (position 17588441)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 17064511
KASP Assay ID:
554-7559.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTTCTCAGGTGTGTGCCCATATTGTCCAAGCCATTCGTATGGAGGCCACA[C/T]GAGTGCGGGAAGAATGGGAACATGCCATCTCCAGCAAAGAGAATGCAAAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41386
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000039157 Nonsense 4542 4574 82 82
ENSDART00000044835   None 3118 83 83
ENSDART00000124901 Nonsense 4616 4648 83 83
ENSDART00000126745   None 631 81 81
Genomic Location (Zv9):
Chromosome 9 (position 17563407)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 17039477
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGAATGTTGACCTGTTTTTCCATTCTTTCCACACAGGACCAAAAGGAAAA[C/T]AGTTAGAGGGAAGCGAGTGTCCCCTGCACGTGGTACATCCTCCCACTGGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link