hsd17b8

Ensembl ID:
ENSDARG00000001169
ZFIN ID:
ZDB-GENE-010110-1
Description:
estradiol 17-beta-dehydrogenase 8 [Source:RefSeq peptide;Acc:NP_001005292]
Human Orthologue:
HSD17B8
Human Description:
hydroxysteroid (17-beta) dehydrogenase 8 [Source:HGNC Symbol;Acc:3554]
Mouse Orthologue:
H2-Ke6
Mouse Description:
H2-K region expressed gene 6 Gene [Source:MGI Symbol;Acc:MGI:95911]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa30708 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa30708
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000001331 Essential Splice Site 251 256 None 9

The following transcripts of ENSDARG00000001169 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 19 (position 7802075)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 7260614
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCTGCTGTCAGTTTGTTGTACTGATCTACACTGTCCTCTTTAATCCATAC[A/T]GGCGGACTCTTCATTGGCTGAAAACAGACTGTTGAATGTGACTCAATCGT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link