matr3l1.1

Ensembl ID:
ENSDARG00000001162
ZFIN ID:
ZDB-GENE-030616-40
Description:
hypothetical protein LOC556124 [Source:RefSeq peptide;Acc:NP_001007137]
Human Orthologues:
CYLC1, CYLC2
Human Descriptions:
cylicin, basic protein of sperm head cytoskeleton 1 [Source:HGNC Symbol;Acc:2582]
cylicin, basic protein of sperm head cytoskeleton 2 [Source:HGNC Symbol;Acc:2583]
Mouse Orthologues:
Cylc1, Cylc2
Mouse Descriptions:
cylicin, basic protein of sperm head cytoskeleton 1 Gene [Source:MGI Symbol;Acc:MGI:1914657]
cylicin, basic protein of sperm head cytoskeleton 2 Gene [Source:MGI Symbol;Acc:MGI:1922164]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa9639 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa9639
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000001323 Nonsense 490 928 8 19
ENSDART00000135004 Nonsense 490 928 9 20

The following transcripts of ENSDARG00000001162 do not overlap with this mutation:

Genomic Location:
Chromosome 14 (position 26150423)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGCCTCAACAAGGTGAGCAAAAAGAGCTTCAAGAGGAAAAGGAGCCCCCA[C/T]GAGAAGAACAAAAAGRAGAGCAGAAAGAAGAGCTTAATCAAGAAGAGCAA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/hjdtpeoz