rimbp2

Ensembl ID:
ENSDARG00000001154
ZFIN ID:
ZDB-GENE-040724-96
Description:
Novel protein similar to chicken and human RIM binding protein 2 (KIAA0318) [Source:UniProtKB/TrEMBL
Human Orthologue:
RIMBP2
Human Description:
RIMS binding protein 2 [Source:HGNC Symbol;Acc:30339]
Mouse Orthologue:
Rimbp2
Mouse Description:
RIMS binding protein 2 Gene [Source:MGI Symbol;Acc:MGI:2443235]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa3694 Essential Splice Site Mutation detected in F1 DNA During 2014
sa13674 Splice Site, Nonsense Available for shipment Available now
sa12091 Essential Splice Site Available for shipment Available now
sa2429 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa3694
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000001313 Essential Splice Site 34 1085 1 22
ENSDART00000136269 None None 1165 None 16

The following genes are also affected by this mutation:

Genomic Location:
Chromosome 8 (position 46121800)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CATTGGCCGTCCTCAGTGCCAAGCAGCAGGAGATTGACCTTCTGCAGAAG[G/A]TGAGAGGCCACACYAGACCCCAGGATCCACTGCAGAAGACCCCGTGTCGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13674
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Splice Site, Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000001313 Splice Site, Nonsense 123 1085 5 22
ENSDART00000136269 Splice Site None 1165 None 16
Genomic Location:
Chromosome 8 (position 46135178)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AATCAGTCACCTTTGTGTATATGTGTGTGTGTGTGTGTGTGTGTGTGTTA[T/A]GAAGGTAATGAGGATTCGATGAGTAAGATCTCGGAGCTCATCCGGCCTCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12091
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000001313 Essential Splice Site 974 1085 19 22
ENSDART00000136269 Essential Splice Site 1056 1165 14 16
Genomic Location:
Chromosome 8 (position 46187911)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCGCTCYAGCACTTGTATATATTTGNTTTTTTGTCCTTYTTTTGTCTCTC[A/T]GAAAGGAAMAAAAGGAGTGGAAGACAGCATGCAGTGTCGACGCGGAGGAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa2429
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000001313 Nonsense 996 1085 19 22
ENSDART00000136269 Nonsense 1078 1165 14 16
Genomic Location:
Chromosome 8 (position 46187980)
KASP Assay ID:
554-2878.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGAAGACAGCATGCAGTGTCGACGCGGAGGATGGTGGCACTGTATGATTA[T/A]GACCCCAGAGAAAGCTCGCCTAATGTAGATGTGGAGGTACTAATGGAGTC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/u0k27zr6