dicer1

Ensembl ID:
ENSDARG00000001129
ZFIN ID:
ZDB-GENE-030131-3445
Description:
Endoribonuclease Dicer [Source:UniProtKB/Swiss-Prot;Acc:Q6TV19]
Human Orthologue:
DICER1
Human Description:
dicer 1, ribonuclease type III [Source:HGNC Symbol;Acc:17098]
Mouse Orthologue:
Dicer1
Mouse Description:
Dicer1, Dcr-1 homolog (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:2177178]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa9205 Nonsense Mutation detected in F1 DNA During 2017
sa19169 Essential Splice Site Mutation detected in F1 DNA During 2017
sa11548 Nonsense Available for shipment Available now
hu715 Nonsense Confirmed mutation in F2 line Unknown
hu894 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa9205
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000045881 Nonsense 459 1865 9 27
ENSDART00000109826 Nonsense 459 1865 8 26
Genomic Location (Zv9):
Chromosome 17 (position 19282841)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 19432852
KASP Assay ID:
2261-0862.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
KATTTCAGACTTATTAAGGAGGCAGGAAAGCAAGACCCAGAGCTGGCTTA[C/A]ATCAGTAGCAACTTCATCACAGGGCACAGCATCGGCAAGAACCAGCCTCG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19169
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000045881 Essential Splice Site 1332 1865 21 27
ENSDART00000109826 Essential Splice Site 1332 1865 20 26
Genomic Location (Zv9):
Chromosome 17 (position 19270054)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 19420065
KASP Assay ID:
2261-0860.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTACCCTGACGCCCACGAGGGCAGACTGTCCTACATGAGAAGCAAGAAGG[T/G]GAGATTTTGTCAAGTTAAAGGAATAGTTTAGCCAGAAATGAAAAATAGTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11548
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000045881 Nonsense 1414 1865 23 27
ENSDART00000109826 Nonsense 1414 1865 22 26
Genomic Location (Zv9):
Chromosome 17 (position 19261891)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 19411902
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACGAGGATGACGATGATGAGCCGGAAGAAGCAGAGGTCGAGCCATCTAAA[G/T]AAGATGTAAATGTTGAAGAYGACCTGGAGTATTATTACGAACACATCCGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
hu715
Current Status:
Confirmed mutation in F2 line
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Unknown
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000045881 Nonsense 1427 1865 23 27
ENSDART00000109826 Nonsense 1427 1865 22 26
Genomic Location (Zv9):
Chromosome 17 (position 19261852)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 19411863
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGCCATCTAAAGAAGATGTAAATGTTGAAGACGACCTGGAGTATTATTAC[G/T]AACACATCCGCTTCATCGACAGCATGTTAATCGGCTCTGGCGCTTTCGGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
hu894
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000045881 Nonsense 1457 1865 23 27
ENSDART00000109826 Nonsense 1457 1865 22 26
Genomic Location (Zv9):
Chromosome 17 (position 19261760)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 19411771
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCTTTCGGCAAGAAGATCTCCCTCCAGCCCACAGACCCCGGCTACGAATG[G/A]AAAGCTCCTAAAAAAGCCCACAACTCCCACTTCTCGCCAGACGGGGGTGC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link