si:ch211-150d5.2

Ensembl ID:
ENSDARG00000001014
ZFIN IDs:
ZDB-GENE-030131-998, ZDB-GENE-091112-18
Human Orthologue:
MYH9
Human Description:
myosin, heavy chain 9, non-muscle [Source:HGNC Symbol;Acc:7579]
Mouse Orthologue:
Myh9
Mouse Description:
myosin, heavy polypeptide 9, non-muscle Gene [Source:MGI Symbol;Acc:MGI:107717]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa18627 Essential Splice Site, Missense Available for shipment Available now
sa39978 Essential Splice Site Mutation detected in F1 DNA During 2017
sa33082 Missense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa18627
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > G
Consequence:
Essential Splice Site, Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092373 Essential Splice Site 747 1686 None 36
ENSDART00000137105 Missense 736 738 16 16
Genomic Location (Zv9):
Chromosome 3 (position 5747958)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 5239929
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTCCATTCCCAAAGGATTCATGGATGGCAAACAGGCCTGTATGCTGATGG[T/G]GAGAGMAGTTTTATGTTTAAACAATRTAAATAAAATCATTAGATGTCMTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39978
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092373 Essential Splice Site 1166 1686 26 36
ENSDART00000137105   None 738 None 16
Genomic Location (Zv9):
Chromosome 3 (position 5739168)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 5231139
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTGAGCTGGAGGACACACTCGACTCTACAGCCGCACAGCAGGAGCTCAGG[T/C]ATACACACACACACTCAACTCCACAGGTCTCTACGTGTAACTAAATACAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33082
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > C
Consequence:
Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092373 Missense 1350 1686 31 36
ENSDART00000137105   None 738 None 16
Genomic Location (Zv9):
Chromosome 3 (position 5736902)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 5228873
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGAGGCCAAGAGGAACCTGGAGAAGCAAATCGGCACTATGCAGGCGCAGG[T/C]ACACACAGCCTCAAAACACTATTCAATTCTGAGTGCACCTCACTCTATAT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link