pcl

Ensembl ID:
ENSDARG00000000972
ZFIN IDs:
ZDB-GENE-051120-144, ZDB-GENE-090908-3
Description:
hypothetical protein LOC553283 [Source:RefSeq peptide;Acc:NP_001032759]
Human Orthologue:
PC
Human Description:
pyruvate carboxylase [Source:HGNC Symbol;Acc:8636]
Mouse Orthologue:
Pcx
Mouse Description:
pyruvate carboxylase Gene [Source:MGI Symbol;Acc:MGI:97520]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa16065 Nonsense Available for shipment Available now
sa23952 Nonsense Available for shipment Available now
sa37328 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa16065
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000001098 Nonsense 204 1181 4 20
ENSDART00000028401 Nonsense 204 229 5 5
ENSDART00000131874   None 784 None 12
Genomic Location (Zv9):
Chromosome 21 (position 26151400)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 26720238
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACAGCTACGGCTTCCCCATTATCTTCAAGGCTGCGTACGGTGGTGGGGGA[C/T]GAGGAATGCGGGTGGTCAGAGAGTATGAGGTACCGTGTCTTAGATTAAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23952
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000001098 Nonsense 1015 1181 18 20
ENSDART00000028401   None 229 None 5
ENSDART00000131874 Nonsense 618 784 10 12
Genomic Location (Zv9):
Chromosome 21 (position 26355538)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 26924449
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCTCACGGTGACGAAATCACTCCAGAGGATGTGATGTCAGCAGCCATGTA[T/A]CCCAAAGTATTCCAGGAGTTCAAGGATTTCACCAGAACCTTTGGGCCTGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37328
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000001098 Nonsense 1137 1181 20 20
ENSDART00000028401   None 229 None 5
ENSDART00000131874 Nonsense 740 784 12 12
Genomic Location (Zv9):
Chromosome 21 (position 26360097)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 26929008
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTAAGGTGGTGGAGGTGAAAGTGAAGCAAGGGCAGCAAGTGGAGAAAGGA[C/T]AGCCGCTCTGCGTGCTCAGCGCCATGAAGATGGAAACGGTGGTCAACTCT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Bipolar disorder: Large-scale genome-wide association analysis of bipolar disorder identifies a new susceptibility locus near ODZ4. (View Study)
  • HIV-1 viral setpoint: Genomewide association study for determinants of HIV-1 acquisition and viral set point in HIV-1 serodiscordant couples with quantified virus exposure. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link