ncor2

Ensembl ID:
ENSDARG00000000966
ZFIN ID:
ZDB-GENE-030616-81
Description:
Novel protein similar to mouse silencing mediator of retinoic acid and thyroid hormone receptor (SMR
Human Orthologue:
NCOR2
Human Description:
nuclear receptor corepressor 2 [Source:HGNC Symbol;Acc:7673]
Mouse Orthologue:
Ncor2
Mouse Description:
nuclear receptor co-repressor 2 Gene [Source:MGI Symbol;Acc:MGI:1337080]

Alleles

There are 16 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa21362 Nonsense Available for shipment Available now
sa7154 Nonsense Mutation detected in F1 DNA During 2017
sa13457 Essential Splice Site Available for shipment Available now
sa14103 Essential Splice Site Available for shipment Available now
sa34468 Nonsense Available for shipment Available now
sa41279 Nonsense Mutation detected in F1 DNA During 2017
sa41278 Essential Splice Site Mutation detected in F1 DNA During 2017
sa15996 Essential Splice Site Available for shipment Available now
sa11868 Nonsense Available for shipment Available now
sa15101 Nonsense Available for shipment Available now
sa1781 Nonsense Available for shipment Available now
sa21361 Nonsense Available for shipment Available now
sa34467 Nonsense Mutation detected in F1 DNA During 2017
sa12530 Nonsense Available for shipment Available now
sa38706 Essential Splice Site Mutation detected in F1 DNA During 2017
sa34466 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa21362
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000001092   None 1999 None 35
ENSDART00000051139 Nonsense 103 2325 3 44
ENSDART00000140618   None 1989 None 35

The following transcripts of ENSDARG00000000966 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 8 (position 45544262)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 43495198
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACCTGCAGGACGCCAGCAGCCAATCAGAAGTGGAGTACTCTGAGATGAAG[C/T]GACCTCGCTTGGAGATTGGGGCGGAGTCTCTTATTCGACACTCATCTCAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7154
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000001092   None 1999 None 35
ENSDART00000051139 Nonsense 196 2325 4 44
ENSDART00000140618   None 1989 None 35

The following transcripts of ENSDARG00000000966 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 8 (position 45528922)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 43479858
KASP Assay ID:
554-5459.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACCGGGAAATCACCATGGTGGAGCAGCAGATCAGCAAACTGAGGAAAAAA[C/T]AGGTAAACKTCACCCCGACCTTCTTGAAGCTGTAAATATGTGATCGAAGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13457
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000001092   None 1999 None 35
ENSDART00000051139 Essential Splice Site 196 2325 4 44
ENSDART00000140618   None 1989 None 35

The following transcripts of ENSDARG00000000966 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 8 (position 45528918)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 43479854
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGAAATCACCATGGTGGAGCAGCAGATCAGCAAACTGAGGAAAAAAHAGG[T/G]AAACKTCACCCCGACCTYCTTGAAGCTGTAAATATGTGATCGAAGGGCTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14103
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000001092 Essential Splice Site 462 1999 9 35
ENSDART00000051139 Essential Splice Site 842 2325 19 44
ENSDART00000140618 Essential Splice Site 462 1989 9 35

The following transcripts of ENSDARG00000000966 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 8 (position 45460088)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 43412870
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AYATGCAGCGCCGATGAGGTGGAGGAGACKGAGAGCTCAGAGAAGAGCAG[G/A]TGAGAGTGTGCACGTGTGTRTGGCTGTGTGTTGATTGGTTACTTGGGTGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34468
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000001092 Nonsense 696 1999 15 35
ENSDART00000051139 Nonsense 1060 2325 24 44
ENSDART00000140618 Nonsense 686 1989 15 35

The following transcripts of ENSDARG00000000966 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 8 (position 45448974)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 43401756
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTAAATTGCAGGGTACTCCAGTGCAACTGCACAATCCATCCCATGGCTCT[G/T]AGCATGGGAAAGTCCCAGCTCCAGGATCACTGGCTCTCTCCTGGGTGGAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41279
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000001092 Nonsense 724 1999 16 35
ENSDART00000051139 Nonsense 1088 2325 25 44
ENSDART00000140618 Nonsense 714 1989 16 35

The following transcripts of ENSDARG00000000966 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 8 (position 45448816)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 43401598
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CATATCCAACATCTCTTTCTGTCTCCTCAGGCGGGTTTCCAGTTGTTAAA[C/T]AAGAGCAGTTGTCTCCTCGTGGGGCTTCCTCCTCCTCCTCTCAGGCTGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41278
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000001092 Essential Splice Site 786 1999 17 35
ENSDART00000051139 Essential Splice Site 1150 2325 26 44
ENSDART00000140618 Essential Splice Site 776 1989 17 35

The following transcripts of ENSDARG00000000966 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 8 (position 45448503)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 43401285
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGTGCACCAGGATTCTCCCATATCATATCGAGGTGGTTCTATCACTCAGG[T/C]GAGAATCTCACACAGTGAAAAGGGTGTTTGCAATTGCTTTTAATGACTGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15996
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000001092 Essential Splice Site 1159 1999 23 35
ENSDART00000051139 Essential Splice Site 1523 2325 32 44
ENSDART00000140618 Essential Splice Site 1149 1989 23 35

The following transcripts of ENSDARG00000000966 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 8 (position 45441548)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 43394330
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTTAACRTTTGATGCYGCAGCTCTGCCCAGGGGYATCCCGATTGACTCAG[G/A]TATTCCAYATATTTGCAGATTAGCAGAAAATGTCASTGTGCAATTTTCCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11868
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000001092 Nonsense 1177 1999 24 35
ENSDART00000051139 Nonsense 1541 2325 33 44
ENSDART00000140618 Nonsense 1167 1989 24 35

The following transcripts of ENSDARG00000000966 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 8 (position 45441362)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 43394144
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TATTACCTGCCTCGTCACCTGGCTCCTGGCCCTGGCTACCCACACCCCTA[T/A]CCACCCTAYCTGATCAGAGGCTGTTTCCCWGAAACAGCAGCCCTGGAAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15101
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000001092 Nonsense 1211 1999 24 35
ENSDART00000051139 Nonsense 1575 2325 33 44
ENSDART00000140618 Nonsense 1201 1989 24 35

The following transcripts of ENSDARG00000000966 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 8 (position 45441260)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 43394042
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGACAAACGCTTTTCAATGACTACATTACCTCTCAGCAGAWGCACCAGTG[G/A]CCTGCTGCYGCTGCAATGGCTGCCCAGAGACCTGACCTGCTCAGAGGCCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1781
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000001092 Nonsense 1321 1999 26 35
ENSDART00000051139 Nonsense 1685 2325 35 44
ENSDART00000140618 Nonsense 1311 1989 26 35

The following transcripts of ENSDARG00000000966 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 8 (position 45440637)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 43393419
KASP Assay ID:
554-1774.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAGAGCAGAGAGAGCGAGAAAGAGAAAGAGAGCGAGAGAGGGACAGGGAG[C/T]GAGATCGAGACCGGGAGCGTGAGAAAGATCGAGACAGGGACAGAGAAAGA
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Mutation Details

Allele Name:
sa21361
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000001092 Nonsense 1437 1999 28 35
ENSDART00000051139 Nonsense 1801 2325 37 44
ENSDART00000140618 Nonsense 1427 1989 28 35

The following transcripts of ENSDARG00000000966 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 8 (position 45439868)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 43392650
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAGGGCTTCAGTGGGCACCTCCAGAGGTCTGGTTTACCCGGTGAGGGTTA[C/A]CCATCTGGAACGGACCCAAGTGCTAAAGACTTGAGCAGAGATGGGGGCAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34467
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000001092 Nonsense 1490 1999 28 35
ENSDART00000051139 Nonsense 1854 2325 37 44
ENSDART00000140618 Nonsense 1480 1989 28 35

The following transcripts of ENSDARG00000000966 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 8 (position 45439709)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 43392491
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GACTCCAAGCTCGCCAGTCCTGGTGCCGGTGGTACATATCCCTCTCCATA[C/A]AACCAGGCCCCTGTTGCCCACCTGCCCACAAGTCGAGGGCACCCCTTGTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12530
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000001092 Nonsense 1687 1999 30 35
ENSDART00000051139 Nonsense 2013 2325 39 44
ENSDART00000140618 Nonsense 1677 1989 30 35

The following transcripts of ENSDARG00000000966 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 8 (position 45430694)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 43383476
KASP Assay ID:
2260-0990.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCACCTAGCACCCCTCAAGCCCAAACCCCCACAGAGCCCAATTCCCGCTA[C/A]ACCCCWGAGGGCACTTCTGCAGARAGGGGCARAGACAGGTCTCCTCCTCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38706
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000001092 Essential Splice Site 1788 1999 None 35
ENSDART00000051139 Essential Splice Site 2114 2325 None 44
ENSDART00000140618 Essential Splice Site 1778 1989 None 35

The following transcripts of ENSDARG00000000966 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 8 (position 45427048)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 43379830
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAGAGCAAGAAGGAAATGATCAAAAAGATCAGCGCAGAGGCTGAGTTCAG[T/C]AAGTCTATGGATTCCATTTATTGTTTCTGTTTTGCAGAGAAAACGCCTGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34466
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000001092 Nonsense 1972 1999 35 35
ENSDART00000051139 Nonsense 2298 2325 44 44
ENSDART00000140618 Nonsense 1962 1989 35 35

The following transcripts of ENSDARG00000000966 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 8 (position 45422458)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 43375240
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGCCGGGACCCTCACCTTCCCCAACACATCCTGGCGCTTCTGCACCCACA[C/T]AAGGCCAGACCCAACCCCGCACCTGGGAGGAAGAACCCAAACCTCTGCTG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link