dzip1

Ensembl ID:
ENSDARG00000000943
ZFIN ID:
ZDB-GENE-040526-1
Description:
Zinc finger protein Dzip1 [Source:UniProtKB/Swiss-Prot;Acc:Q7T019]
Human Orthologue:
DZIP1
Human Description:
DAZ interacting protein 1 [Source:HGNC Symbol;Acc:20908]
Mouse Orthologues:
Dzip1, Gm7337
Mouse Descriptions:
DAZ interacting protein 1 Gene [Source:MGI Symbol;Acc:MGI:1914311]
predicted gene 7337 Pseudogene [Source:MGI Symbol;Acc:MGI:3646689]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa8922 Splice Site, Nonsense Mutation detected in F1 DNA During 2017
sa26672 Essential Splice Site Mutation detected in F1 DNA During 2017
sa20624 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa8922
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Splice Site, Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000049695 Splice Site, Nonsense 429 886 8 18
ENSDART00000083424 Splice Site, Nonsense 440 877 8 17
ENSDART00000125912 Splice Site, Nonsense 440 897 8 18
ENSDART00000136088 Splice Site, Nonsense 429 866 8 17
Genomic Location (Zv9):
Chromosome 6 (position 7182723)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 7108739
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGAGCCACAGACTGCAGGAGCAGCAGCAGATCATTACCWCCCAAAACAAG[C/T]AGGTCAGTCTTGGATGCCAGCACAGGAAGAGGCTCCATTGTTCAGGATAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa26672
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000049695 Essential Splice Site 445 886 9 18
ENSDART00000083424 Essential Splice Site 456 877 9 17
ENSDART00000125912 Essential Splice Site 456 897 9 18
ENSDART00000136088 Essential Splice Site 445 866 9 17
Genomic Location (Zv9):
Chromosome 6 (position 7183037)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 7109053
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GATGAAACAGATCTCGTCAAAGCCGCCAACAATAACAGTACAGCGCGAAG[G/A]TTTGTGGATTTTACAGTTTTAGTCAAAAATATCATATAAACATCGTATCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20624
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000049695 Nonsense 593 886 13 18
ENSDART00000083424 Nonsense 584 877 12 17
ENSDART00000125912 Nonsense 604 897 13 18
ENSDART00000136088 Nonsense 573 866 12 17
Genomic Location (Zv9):
Chromosome 6 (position 7189851)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 7115867
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGGTGAAGGAGAGGAACACAGAGCAGCCTGTCAAACCCAAACTACATGAA[C/T]AAGGTCAGGATCTTTGATTTCACACACAGTATCAAAGCTGAGATATTTTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link