unk

Ensembl ID:
ENSDARG00000000935
ZFIN ID:
ZDB-GENE-040426-707
Description:
RING finger protein unkempt homolog [Source:RefSeq peptide;Acc:NP_956530]
Human Orthologue:
UNK
Human Description:
unkempt homolog (Drosophila) [Source:HGNC Symbol;Acc:29369]
Mouse Orthologue:
Unk
Mouse Description:
unkempt homolog (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:2442456]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa12996 Nonsense Available for shipment Available now
sa740 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa12996
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000001053 Nonsense 177 737 3 15
ENSDART00000131300 Nonsense 177 777 3 15

The following transcripts of ENSDARG00000000935 do not overlap with this mutation:

Genomic Location:
Chromosome 12 (position 37222914)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCTCAYTGTGCCTTTGCTCATGGGTCACATGACCTCAGAAGCCCTGTATA[T/G]GACATCAGGTGWGTAGCTGGTCTTCAGAGCAGTATTTCATCTGTATTTCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa740
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000001053 Nonsense 647 737 14 15
ENSDART00000131300 None 646 777 14 15

The following transcripts of ENSDARG00000000935 do not overlap with this mutation:

Genomic Location:
Chromosome 12 (position 37190309)
KASP Assay ID:
554-0647.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGATTGTATTTTTTNCTGTCTTAGTCCCTGGCGGTGTTGAAGGCGGATGC[G/T]GAGGACGCTCGTCTACTGGCAGGGCAGCTGGGAATGGAGGCGGARCGAGC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/47r3i9uv