scrib

Ensembl ID:
ENSDARG00000000861
ZFIN ID:
ZDB-GENE-030616-572
Description:
Protein scribble homolog [Source:UniProtKB/Swiss-Prot;Acc:Q4H4B6]
Human Orthologue:
SCRIB
Human Description:
scribbled homolog (Drosophila) [Source:HGNC Symbol;Acc:30377]
Mouse Orthologue:
Scrib
Mouse Description:
scribbled homolog (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:2145950]

Alleles

There are 7 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa34144 Nonsense Mutation detected in F1 DNA During 2017
sa21043 Essential Splice Site Available for shipment Available now
sa12569 Nonsense Available for shipment Available now
sa12563 Nonsense Available for shipment Available now
sa12522 Nonsense Available for shipment Available now
sa21044 Nonsense Available for shipment Available now
sa34145 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa34144
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000021013 Nonsense 88 1181 3 27
ENSDART00000074212 Nonsense 141 1724 4 40
Genomic Location (Zv9):
Chromosome 7 (position 43950094)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 40940394
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCACGCAGCTCCGAGGACTGGCTCACCTATCACTCAATGACGTGTCGCTG[C/T]AGTCTCTACCCAATGACATAGGAAAGTGAGTTGATAAGAACAAATTCAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21043
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000021013 Essential Splice Site 592 1181 15 27
ENSDART00000074212 Essential Splice Site 759 1724 17 40
Genomic Location (Zv9):
Chromosome 7 (position 43967441)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 40957741
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAGCATAGCAGGAGGGAAGGGATCTACTCCCTATAAAGGTGACGATGAGG[T/G]AAGTTTCCACGAGCTTTCAGTAGTTAATTCAGGTTTGCATTACAAACATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12569
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000021013 Nonsense 613 1181 16 27
ENSDART00000074212 Nonsense 780 1724 18 40
Genomic Location (Zv9):
Chromosome 7 (position 43967968)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 40958268
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCTCTAGGGTGTCAGAAGAAGGYCCTGCGGCTCSTGCTGGTGTCAAAGTT[G/T]GAGACAAACTTCTTGAGGTAAACAWCTGTGAGGATTTGTCTACTTTGACT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12563
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000021013 Nonsense 640 1181 17 27
ENSDART00000074212 Nonsense 807 1724 19 40
ENSDART00000021013 Nonsense 640 1181 17 27
ENSDART00000074212 Nonsense 807 1724 19 40
Genomic Location (Zv9):
Chromosome 7 (position 43968143)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 40958443
KASP Assay ID:
2259-9314.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACCWGCACGGAGCGGAGCATCATACAGCTGTTGAAGCTTTGCGCAATTCA[G/T]GAGCAGCCGTGGTCATGACTGTTTTGCGGGAGCGCATGGTGGAACCAGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12522
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000021013 Nonsense 640 1181 17 27
ENSDART00000074212 Nonsense 807 1724 19 40
ENSDART00000021013 Nonsense 640 1181 17 27
ENSDART00000074212 Nonsense 807 1724 19 40
Genomic Location (Zv9):
Chromosome 7 (position 43968143)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 40958443
KASP Assay ID:
2259-9314.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACCWGCACGGAGCGGAGCATCATACAGCTGTTGAAGCTTTGCGCAATTCA[G/T]GAGCAGCCGTGGTCATGACTGTTTTGCGGGAGCGCATGGTGGAACCAGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21044
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000021013 Nonsense 906 1181 21 27
ENSDART00000074212 Nonsense 1073 1724 23 40
Genomic Location (Zv9):
Chromosome 7 (position 43977766)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 40968066
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTGATCGTATCTTGGAGGTGAACAGCATTGATCTGCGTCATGCCACACAC[C/T]AGGAGGCTGTTAGAGCCTTGCTTTCCAACAAACAGGAGATCCGTATGCTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34145
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000021013   None 1181 None 27
ENSDART00000074212 Nonsense 1408 1724 33 40
Genomic Location (Zv9):
Chromosome 7 (position 43991031)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 40981331
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTGGGTAGGCACAGTCCAGAACAGCGCTCCTTCAAAGACAGACAAAAGTA[T/A]TTCGAGATCGATGTGAAGCAACAGACTCCAGACAAACCCAAACCTCGCAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link