dstyk

Ensembl ID:
ENSDARG00000000853
ZFIN ID:
ZDB-GENE-040826-2
Description:
Dual serine/threonine and tyrosine protein kinase [Source:UniProtKB/Swiss-Prot;Acc:Q4VSN1]
Human Orthologue:
DSTYK
Human Description:
dual serine/threonine and tyrosine protein kinase [Source:HGNC Symbol;Acc:29043]
Mouse Orthologue:
Dstyk
Mouse Description:
dual serine/threonine and tyrosine protein kinase Gene [Source:MGI Symbol;Acc:MGI:1925064]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa37393 Nonsense Mutation detected in F1 DNA During 2017
sa24044 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa37393
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000067637   None 857 None 13
ENSDART00000106645 Nonsense 509 885 6 14
Genomic Location (Zv9):
Chromosome 22 (position 458934)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 446042
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCTTCCACTCCGGTTCATCCGTCACGCGTCTCTTCTGGGAGCAGATCAAA[C/T]AGGTACGTTATCCACAGCGCCCCGCTCATCTGATTACCCATGATGCTCTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24044
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000067637 Nonsense 498 857 6 13
ENSDART00000106645 Nonsense 526 885 7 14
Genomic Location (Zv9):
Chromosome 22 (position 458807)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 445915
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATCATCCACCGCATCACATGGGTCAATCCTCCAGCCATCACGGCCGAGTG[G/A]AAGCGGAAGGTCGCGCAGGACGCCATCGAGAGCCTGAGCGCCGCCAAACT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link