telo2

Ensembl ID:
ENSDARG00000000830
ZFIN ID:
ZDB-GENE-061103-523
Description:
Telomere length regulation protein TEL2 homolog [Source:UniProtKB/Swiss-Prot;Acc:Q7T006]
Human Orthologue:
TELO2
Human Description:
TEL2, telomere maintenance 2, homolog (S. cerevisiae) [Source:HGNC Symbol;Acc:29099]
Mouse Orthologue:
Telo2
Mouse Description:
TEL2, telomere maintenance 2, homolog (S. cerevisiae) Gene [Source:MGI Symbol;Acc:MGI:1918968]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa3284 Nonsense Mutation detected in F1 DNA During 2014
sa8049 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa3284
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000000915 Nonsense 511 822 11 20
ENSDART00000131975 Nonsense 511 816 11 20
Genomic Location:
Chromosome 24 (position 39319658)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCTGATCAGGAGAAGAAGAAATCRGCGCCGCCGCGTTAYGTCAGAGACTG[T/A]CTGGAAGGTGATCTACAATAGTTTTAGCTAGCAATAAAACTCCCCTGAGS
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8049
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000000915 Nonsense 675 822 16 20
ENSDART00000131975 Nonsense 669 816 16 20
Genomic Location:
Chromosome 24 (position 39323171)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CATTGWGTTCAGGGTGTCACTCAACCTGTTAAAGCTGTTCCCAACCGYTA[C/A]GCTCCGGTCGCTGGATTTTTCTTCTTCCCGCTGYTYAGGAGCTATGACAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/vu7zkaf7